Description :
From Genome Similarity Track
Location :
Scaffold_1266:1224- 2283
Transcript NameFunction/comments
g16579.t1hypothetical protein
g16580.t1hypothetical protein

Sequence
1059 bases(100 bases per row)
TATGTGGCCATGTCAAGGGTTACGTCGAGGTCGAGATTCAAGGCGTTGATCGAGTATCCAGAGCGGGAGGAAGAAGACGGAGTGTACACGGCGAACATAG
TGTACCGACAGCTGTTCGAGAGGGCGTAAGCAGCGACTTCGTGTGAATGCATATTTTACGAAAGGAATATATTTGTCACTTTGCATAGCGGTAATTGTTG
AGAGTCACCATTCCCCCTCGAGCGCAGCGAGCACGCCTGTGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAACAGTGCATGGTA
GACAAGCGAAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTGTGGTACAAGTCTACTGTAAAATATACTGAGATAAAACATAACCCTGTCATAGTAA
AAATAGTAGTGAAGCGAGCTGGATGAGCGAGCGAACGGGCACCAACCAACCATGCACCCACCGCCCGCAACGCGGGCGGCGTTCGGCTAGTCTCCTACAA
GTAACAGAGTAACCTGTCCGTCCGTCCGTCCGTCTGTCTGTCCGTCATTCCGTACGCACCCGGAGCGTAACGCAAATCCGGACTTTCCGTTGGCTATAAA
TAGCTGCCGAGCGCAGCGAAGGCGGCCTCCCCATTCGCTATTATTATAATACGAGGCCTCTCATTGGCTATTTAGTGGAGCCTCTGCGCGATTGGCTATT
ATAATGCGTAGAGTGGACTACATCACATCGGAAGTAGCCGAATGAAATCACTGCTGATTGGACAAAATAAACCGCCTTTCAACAACGTTTCTTTTCATTC
CCATACGTGGTCGAGTTTCAGAGAGATTCCAGGCAAATTCTCCCGGTGGTGAAGGGCGGCTCGGCGACAGAGACAATCGACGCATGCCTGAAGTCATCCG
AACTGTGGCCACTTTTCCAGAAGGTGCGTCTGACAGAGAACATGCGTGTTCGCACGGCTGCCACCTCTGATAGTGCTGCTGAAATGGCTGCGTTTTCCGA
GTACCTGCTGAAGGTTGGCGAGGGGAGACACGAGGTACACAATGATCTGGGGAATGACT