Description :
From Genome Similarity Track
Location :
Scaffold_114:122396- 124854
Sequence
2458 bases(100 bases per row)
AGGTGGACGAAACACAAGACGTGGGAACCGTACAAGAAGTACGTTGCTTCTCTGGGACGCTTGGTACACGTGTCTCTGCAGGATCCGGAACGCTTCTACT
TGCGACTTCTCCTGTGTAACCGACGCTCGCCTAAGTCGTTTGCGGATCTTCGAACGGTTGATGGTACGGAACATCCTACATATCAGCAAGCCGCTTTGGC
GCTTGGGTATTTGGAAAATGACGACGAGTGGATACATTGCTTACGCGAAGCCGCCGAGGTCAAGATGCCGTACCAGCTACGCCAACTCTTCCGCATCATT
TTGGTTTACTCCATGCCTGGTAATGCCAAAGATCTACGGGACAGGTTCAAGAAGGATATGTCAGAGGATTATGCACGAAGCATTGAGGTAAGAGACGCAG
ACCTGCATAATGTACGCGAAGAGCAGGTGCGTCTTCGAATGGCGGAGTACAAGGCGTTGAAGAATTTGGCTGATTACTTGGTTTCGAGCCAAAAGTCCCT
CGATATGTACGGCCTTCCTCTGCTAGCCAATTACGACGATGTATCTGCTCAAGTGGACGACCCGGATACAGCGTCTGTTGATGTTGTCCAGCAAGAGATT
GATGCATACTCCCAAAACGAACTGGAGCATGCTGCGGAGCTGGTAGACCACTTGAACAGCAACCAGAGGGATATTTTTGACCAAGTTATTGCTGCTGTGA
GCAGCCCGGTTGGAGGAGAGAAGCTTTTCTTTTTGGATGGTCCGGGCGGAACAGGAAAGTCGTTCCTACTCGAGCAAATACTCGCTCACGTTCGGATGCA
ACGTAAGGTTGCCATCGCGGTTGCATCGAGTGGGATTGCAGCCACTCTGTTAACCGGAGGTCATACCGCGCATTCAACGTTCCGGATTCCCCTCAAACTA
ACAGAGACGTCGACGTGCAGCCTTTCATGGCAGAGCCAAAAAGCCGAATTGATTCGTAGCGCGAGTTTGATCATTTGGGACGAAGCGCCGATGATGAACC
GAGCTTGCTTTGAGGCTGTTGACAGGTCGCTTCGGGATATTATGAAGAACGAGCTGGAGCCGTTCGGCGGAAAGGTAATGGTGTTCAGCAGTGATCACCG
CCAGATTCTACCTGTACTGAAGGATGCTACGCGTGCGGAGACGATTCAAGCTTGCTTCAAGTCTTCTCCCCTATGGGAGCATTTGAGTCAAGTGCGGCTG
ACCGAGAACATGCGTGTCCGCACCGCCCCAAATGCGGCCACTGCGGCTGCGTTAGCGGAATTCTCTGAATTTCTACTTCAAATTGGAGAAGGCCGTTACC
CAGTCCACCATGAGATCGGTGATGGCGATATATGCCTCCCACGCGATATGTGTATCATTCCAGAACGACGGGTACAACAAATGACCTCTGACGAAGAAGA
CGCGGATATGGAGCCTCCACCAAGTTTCAGGCTACTATCTCCGGCGGACGAGGAGCACGAGCGAGACTTGGACGACGTTGAAGAAGACCGACGAGTCCAC
AACGTCAACGCACTCATAGATGCGGTGTACCCGGGCGTTGATACTGAGAATTTACCCGATGAATACTTCGTTGAGCGAGCCATACTAGCCCCCACAAATG
CAAGTGTTCGGCGTATCAACGACATGGTTGCGGAACGGCTGTCGGGTGAAACGAAGGAGTATCTCTCGGTGGACAGCCTCGAAGGGGTCGCGGATGCAAA
TATGTTTGAGCAGGAGTTCTTAAACTCTCTCAACTTCTCCGGTATCCCTCCGCACAGGATTGTTCTGAAGGTTGGAACACCTATCATCATGATTAGAAAC
CTGAATAGCGACGCATGACTTTGCAACGGAACGCGGCTTCGGGTTGTGTCACTGCGCGCGAGAAGCATCGAGGCCAGCATTATGTCCGGGCCGTTCAAGG
GTAAGAAGGTGTTCATTCCTCGGATCGTCTTTTATAGTGAGGACGATGACAAGGAGTTCCCGTTCAAACTCAAGCGTAAGCAGTTCCCCGTGGTTCCAGC
GTTCGCCATGACTGTCAACAAGGCCCAAGGACAATCGATCCATCACGTGGGTATATACTTGGAATCACCGGTCTTCGCACATGGGCAGCTTTATGTGGCG
TTGTCGAGAGTGACTTCGAGGAAGGCGATCAAGATTGCTGTAGATCCAGAGGCCATCGATGAGGACGGAAACGTACACACCAACAATATTGTGTACAGAG
AGATCTTTGGAACGCGGACTTGGTAGGGCACGTAATACATATAATACATTTAGCTTTGATTTCAGAATATTCTTTCATCCGCCGCAGCGCAGCGGAGGCG
GACAGCCCACACTACACCAACCAACCATGCCCTAGCGTCCGCGGAGCGGACGCCCAGAGCGCTAGTTTCCCGCCACCTAACCTTCTAGCGTGTCTGTCCG
TCTGTCAATAAGTCCGTCCGGTTCCTTTCTTGCTGCTTTTTCCTACCTTTTCGCATGG