Description :
From Genome Similarity Track
Location :
Scaffold_242:12238- 13351
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_242-fgenesh-gene-0.3Gene of unknown function

Sequence
1113 bases(100 bases per row)
TTGTCGCGCATCGGTGATGGGGATCGTGCTGGCTGGCCAACTTCCACAGCGGCAGGCACGACTCCAAAGCAGGGCGCGTTCTTTCGGTTGTTCATGCTGT
AGATAAGTTCTTTCGTGCAAGTTTACTACGGCAGTACCGCAGTACTACACCATAGGCACCTCTGGCGGTCGTTCTCCGTAGACACGCAGCAGCGTCTTGA
TCGCGGCCACAAGAATCCCATTGGTTGGAGTGCCGTCAAGCCCGGCTAGCACCTCAAACCCACCAAGTCCGTCGATCGACAGCACGGCCGCCCCGTGCTT
CTGTGCCAGTTCGAGCAACACGCGGGCCGCCGCGTCACGCTGCTCGGTCGACGCCTTCTTCACGTGGTCCAAACAGAACTGGAGAAGATCTTTGTTGGAC
GCCACGGCCTCTGCCAGTGTGGGACTGCCCGACGCCACGATCTTCCCCAACTGCTTCAACGCGTCCACACCCGCACCGCCACTCAAATGGGCCTGCAACG
CCTCGACGCCCCGAGCCTGACAAAACATGCACGCGTTCATCGGGTCCTTGAGCAGTGGCGTGAGTGCTGTGAGGCCACTGCGCCGCAGTCGCTCGTGCTG
GGATTTCAGCAGCTCCACAAGCGGCACGATACCTCCGCGAGAGCCAATGAGCGAGGCACCGTTCTGGTGGGCGACGTTGGTGAGCACCGAGGCGACATGT
TCTTTGATCTGCGCACTCGTGGCGTCCTCGAGTGCAGTGACTAATCTGTGGATGATACGCGATGACTGGAATTGTGGAGCAGTCGCTGGGTTCTTGGAGA
GACGGGTGAGCTGCTCAGCTGCCGAGACGTCACCATTCTGGAGCTGTTCGAGAAGGAGCTGGAGATCCGACGTCCCCATTTCGGTGTCCGCAGCAGGGAC
CGTCTCACGTCCGCTGCTGGGTGGAGCAGCTTCACTCTCGGCAAACTCCCCGAGGAATTTGATCACGTCCTCGAGCGGCAACCGGTCCTTTCGCTCTTTC
GTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNN