Description :
From Genome Similarity Track
Location :
Scaffold_63:122375- 123600
Sequence
1225 bases(100 bases per row)
TATGCCGTTTGCTGGATGAGCACCGGAGACATCCTCACACATGGCGCCAGACGTTGCAGGACCGTCTTCAGCGCTGTTATCTTGTGTTGTTATTAGACAC
GCGACCTTTTCATCTAAACTATGCAGGTCTGCAGTGGTGAATAATTCCATCTCTGAGTCAACCTCATCCGCAAAGCAAATAAATCCGTTCATATCCATTA
GGTCGAAAATGCGCAGGTGCTTCATCTGTGCCAGTATACTGATGTTTATCTCCTCGTCGGCATCGATCTATGATCTGCTCGTGGTAGTGAGACCAAGTTA
ATTCCCGTTTCGTTGGAAGCAAATCGAAATGAAATCGCTCAAAACCTTACGCCAGCACGATTTGATCCACCTAACCGCTGTGAGATGATCAATCATGTAG
ATGCTAGATTGGGATCCTTGCTCGTCCGTTTTAAGTGCATTTTGTAGCAGTTGATGCCGGTACTGACGCATAAATGACGCGATGATACTGGCGTCCAGTG
GCCGCAGCTATGATGTCGTATTGGGAGGAAAGAACACAACGGTAACATTATGCAGTTTTACGCCATATAATGTGTGCGCTGAAGAATTTTCAAGGATAAG
TACAGCGTTGCGCCGTTGAGAGTGCATATCTTTGTCACGTAGCCCATCTCGAAAAGGACAACCGTCATCCACACTTTATGATTACTTTGATAGTAGATCC
CCAAACAATCACCAGGCTTCTTTTGAAAGCAGCAAAGCTTCTTTGCTTGTCCAATGACGAACGGCTTGCGTTCGTCGGAGACATCGGCTTTGCACTATAG
AGCAACGGTCACTCGAGTCTTGATCTTCTTCAAACCTTCCACTTGATGCCGAGCGATGGTTTGTCGGTTGCGAGGCAGTAAAAATTCCCGTTTCACCCAT
GTTGTAGATATCGGCTAGCGAGAACCCTTTCAAGAATTCTCGTACATCTTTACGCTGCACCGGTATTTACACAGCGTTCACAAATCCGCTCTCACCGTGG
GAGTTGATCTGCTTATAGCCATGAAACGCCTGAAATACCTGGAGCCATCCATTTGAGAATGACAGAAGCTGGTCGTCGTGGACACCGCTCAGCGTTGCAG
AGAGCTTTGATTTCAGTTTAATCATATATCCACTCAGTATCAGACTTTTAGATTTGCACTGCAGCACCCAATTGGCAAGATCTTCATCGACAGCCGGAAA
GAGAAGCGGTCGCGTTCGCTTGCAC