Description :
From Genome Similarity Track
Location :
Scaffold_16:122370- 135893
Transcript NameFunction/comments
Sapdi_VS20SDRG_05897hypothetical protein
Sapdi_VS20SDRG_05898hypothetical protein
Sapdi_VS20SDRG_05899hypothetical protein
Sapdi_VS20SDRG_05900hypothetical protein

Sequence
13523 bases(100 bases per row)
CTTGACGTCGACGCGGACGAGTAGCTTGAAAGGCTTGAGCGGCTATCCGACGACGAGACATAGGACGTGGTCGCCTCCGAGTCGGAACTCTCGAGCGTTG
CGTCGTCGACAGCAACCTTGGCCAGCGCGTCGACCAGCCATTGGTGCACGAGCGTGGTCGCCACGGTTTGCTCCGTCTTGACAAGTGCCGTGTGAGGCGT
CGTCACCGTCGCGGGGGGTGCCGGGGGAACGGGTACTGACGCAGGAAGGGCCACTGAGGGCACGACCGGTGGTGAGTCTCCTTGGGCTTGGTCGTACGTC
GCTGAGACTACCTTGGCCGCGTGGACAGCATCGGCTGCGGTAACTTCCATCGACTCTGTTAGCCACGCAGACAAGAGGTGCCGGGATAGAAGCGCACACA
AGGTCGGATCGACTGCAGAGGAGCTGCTCGCTTCGTGAGACTCGGGGGTGTCGGGACGCTTTGCTGTTAGTGGGGCGTTCTCGTTGACCGACACGGCTGA
TGCGTCATCGATGAGCGAGGTGCTCTGCGACGGCTCGCAAGCAGACGTAGCCACCGAGGACACGGCTTCGTGTAGCCAAACACGCACGAGTTGCCCCGCA
ACTAGAGAAGCGGCGATGGCGTCATCAATGGGCAAAGAGAGCTCCGAGTCCACGCGCCAGAGTGGTGCAGTAGGCGTCGTCTTGACGACATCTGGCAACT
TGGACGCCGGCAGCGGCTCAAAAACGTCGACTGGCAAGCGCTGGAGCTCGGACATGCTCGGGACGCCATCCACAGGAGCAGCGCCGGCCAGGGCGTCGTC
GAGCGGCATTGAGGGAGGTGCTTCGCTGTCGCGACCATCGTCGATACCAGACAGGTTGTCTGCACTTGCTGTCAAGGGCAGAACGGCCTGCCACGCGGCA
AAGCCAAAGTGGCTGGCCACGTTGGCGTACAGTCCTTGAGTTGGATGCGTCCGGACGACTGGCAAAGCGTCGACGACGTCGATCAATGAGGGCGGCGTCG
CGCTGGCATTGAGGACGAGCTGCTTTGCAACGCAGCTCACACTGGCTTCATACAACCACCCACGCACGAGTTGCCCCGAGAGCATCGAGGCAACGACAGC
GCGATTGATCTCGTCCATCTCGCTTGCGCTCGGCTCGATTGCTCTGGCTTCTTCGACTTTGCTCGGCACCCGTTGGAGTGTTTCGTTCATGATATTGGTG
GTCTCGGCAATGACGGTGTCGGCGATAGCACTCGACGTCGCACCCGCTGTGAGCTCGTGGCGGCGCGCTGTCAACTGGACGATCTCGTCCATTACGGTGT
AGGTCCACGCGCGCACCAGCTGTCCGGCCAAGATGGACATGGCTACCGTGCCGTCCTGAGATTCTTCGGACGAGTTGTCGTCCGGGTTCTCGCGCATAGA
CACTGCGACAAAGGATGCGAGCGGAGCGTCGTCAACGACATCATGTGGTGACGCAAGCTGTTGCGTTGCTCGTTGGACAATGTTGTCCATCACATCGTAG
ACCCAGATGCGAACGAGTCGTCCGGCCATCACTGACGTTGCGACGATGCGACATGCGTCACTGATGTCGTCAGACTCCATGTCGGCCGTCTTGACACTGC
TTGGAGGCACCTCGATGGCTGCCATCTCCGTCTCGGTAGACAGTCGCGAAAGCTCGTCTTGTGGCTTCTTGGTTTGGGGCTCGCTTAGCTTGGCCGAGCG
CTGGACGATAATGTTGTCCATAGCCTCGTAGACCCACGCACTCACGAGCACGCCTGCGAGGATCGAGGCGGCTACACTCGTGTCGTCGCTTGTCTCCGCC
TCGTCAACGACTACGGGTGTCACGGATAGCGTAGGTCGCGCGTCATCACCGACCACAGGTGGCGTAGGAGCTTCGGCTACAGCGCATGCTGCAGCGTCCG
CAGCATGCTCGTGGCGTCGTGCTGAAAACTGCACAACTTTGTCCATCGTCTCAAACAGCCAAACACGGACAAGTTGTCCGGCAAGGATCGAGACTGTCAC
GTTGACGAGATCGTCGTTCTGTGCCTCGTCGTCGGACAAAGGCTCGTCTGCAGCGCGGCAATCTTCCTTGGCGGTCGCGGCCGCTGACGAGGGCGTCGGT
GTGACAATGACATCTGTTGCGACTGTCAAACGCTCGGTGCGTCGTGCTGAGATTTGTTGAGCGACCTCATCCATGGTCTCGTACAACCATCCGCGCACGA
CTTGACCAGCCAAGACGGACACGGCGACGTTGACGAGGCCGCCCTCAGGTGGCTTGTCTTCGGACGACTGCAAGACAGCGACCGGAGCATCATCATCGCA
AACTTCCAGCGGAGCTAGATATGCAGCAGTAGACGCCAGAGTGCGTTCCGCAATGACATCACAGGTCTCGTAGAGCCACACACGCACGAGCCGGCTGGCA
ACAAAGGCCACGGCAACCTCTTCGTCGTGAGCCGCCATATCGAGAGCATCGACTTCGCTGGCGTCGATCGTTGCCAGCGCAGACAGTGGTGTCGGAGCAT
CTACCGTCTCTTCGGGCTGAGGCGACGAAGCAACGTTATTAAGTGACGACGAAGGGACATCCTCCAATGTCGCAGCGGTGGTAGCGTCGTGTTCATGCGA
GCGGCATGTAAACCAAGCAACTTCTTCCATCATCTCGGACAGCCACGCGCGCACGAGGTGGCCGGCGAGGATCGAAACGGCGACCTGCGAGCGCATACTG
TCGTCTTCGTCCATTGGCGGTAGCGACGGACACGCGTCAAGGCCAGGCGGGTCGACGACCGACACGACCGGCGGTTGTTCCGACGCCGTCTCGATGCCCA
CGATTGAAGTCAGCGCAGAGTCGCGTTGGGTGGTCATGGCTCGCACAACAGCGTCTGTCCATGAGTGCACAAGCTGCGACGCCATATCCAGCCGCAACGC
GTCCAGCTGGATCTCGGTGATGGTGAGATGGTTATTTGCTTGCGTCACAGATGCAGCGTCCGTGGCGGTACCGGCCGCCACCACCAACGTCTCCTTGGAC
TTGGTGTTGGTCGCTAGCGATGGACTTGGAAGACCAGCTGCAAGCATCGCGACAGCGTCGAATGTTGCAGCGCGGGCAAATTGACGGGCAACGCTCACGA
GATCGTCCACGTCCGCAATACATGGTTTCGTTGGCATCGGGTCCGCGTCGGCCCGCTCGTCGGCGTTCATCGACGGCGTCTTACACGAGCCTTTACCCGG
TTGGGTAGCAGCACTGCATGTCACCAGCGCAGCTTGCACCCAAGCGTCGACAGCGCGTGTGGCTGCAAGGGCGGTCGGGCACGTGCCAGAGATCTCGGCT
TTGGTCTCGGTGAACGGAGTGGACTCGGTCGCGCATGCCTCGGGCTCGGGCTCGTCGCTGTACTTGGCGACAGACGGCAACGGCGCGCAGAGAACGCGGC
ACGCGGCATCGATGCAGCTTTGGGCGACCGTCGCCGCCAGAGATGCCACGTCATCGAGGTATTGCAGCGTCGCGAACGACCCCTTGGGCATACCAGCGCC
GCCGGCAACAGCCTTTGCAGCGTCGGACGCCGGCACGTGCTGTGACGCGACGGTGGCATGAGCAATGGTAGCCACTGTCGTGGTCGCAACCGACAAGGCT
GCATCGGTAACCCACGCGTGGACATGCTGTGTGGCGATCGACCTCACAGCTTCCGTCGATGCGTCTGTATTCAGATTCAAGACCGTCTTGACGTCCGAGG
GGGTCGCCTCCAAATGCGATAGACGCTCAACCTCCTTGTCGACGGCGGCGTCGACGACAGTTTCTATTCTAGCACTCTTTGGCTCGTAGATTGCCGCATG
CAGCCACGAACGCACGAGGTTGCCGGCCAAACGAGACGTTGCAACGTCGCGAGCGTGGTCCCTTTCGTCGGGCGCGTCCCGCGGTGTCGGTGGCAACGAG
AGCAATGGCAAGGCCGGCGCCGCGCGGGCCACTTGCGGTACTGAGGCAATTGGCAGCGAAAAACACGCCACAAAGGTAAGTAGTTTGGCGACCGAGTCGT
AGATCGGCGCGTCCCACGACGTCCAGACCACCGACGGCGCTCTCATTGGCTCGGTGGCGTCTGTGGTCGGCGGCACCTCGACGGTCGTTCCCAGCGTTGG
GCCCATCTCTGGCTCCACCGCAGCGTCCATGGCCAACTCATCGATCGCAGTTTGGGCCGTCGCTTTGCTGCTGCCGGCGTCGGGTTGCAACGGAGATGCT
TGGTTGAAAGCCGCTTGAACGCCGAAGTAGACGGCTTCCTCGACCATGGCGACGGCCACTGTCCGCACCGCCGAGCCGCGTGCATCTCCGCAAGCTAGTG
CAGAAGCTGGCGGTGTCGCCGCGACCCCGGTTGTCGGCGGATATGTGAGAAAGGTGAAGAGTCGTGCAACGCTGTCGTAGACGCTGCGATCGGTTGGCGT
CAGTGAAGCCCACACCTCAGACGGTGCAAGTACAGGTGCCGAGGACAAGGTCTCAGCGATGGGCACGACGTTGTTGCCACTGAGGAGTTGCCACAATGCG
CTCTCACCGCCCTCGAAGAGCCAAGACCGCACAAGCGGTCCTGCCAAACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGTCTGTCCATGCGTGCACGAGCTGCGACGCCATTTTGAGTGTGTGGTGATGCAAACTTGGCTG
CGCGTTGGGGGTGATATCTCTGGCGCTGACCAGCGGAGACACCAAATCTGGAACCGGGTTCGAATCTGGTACGACTTGCGTTTGAAGATCGCGCTCGTGC
GGCCGAGATGTGCACCAAACGACCTCGGCCATCGCCGCTTGCGTCCAGGCGCGGACCATGCGACCGGCCGTGATCGAGATCACTACCGTGTGGTCAAAGG
CTTCTTCGGGCGTCTCGAGCGGTGCTTGGAGCAAAGAAGCGGCGCTCGCCGTCTCATGGCTCGTCGTGATACTCGCCTCGGCACTTTGAACGGGGCGGGG
ACTGGAGACACCTTGTGATGACGCGCTCAAATGACCAACTTCGCTTGGCGCATCGTCGAAGATGCTTGCGTCCTCGAGATCGCTCGGTCGGGCGTCTGCG
TCGCCAGTGGTTGCCGACGCCATCGCATCATCAAAGGCAGCTTCCAGGTCTAAATCGTCCAGAGCATCGATCTTCGGGGCAGACGGGCGCCGTGTCGCTT
CACTCGTCAGATCAACCGTGTTCTTTGACGCGGTGGATGCATAATCCTCCGAGGTAGCGTCCTCGCTTGCGCTTGCGTCAACGCCATTTTCTAACGCCGT
AATCATGTCGTCGCAGACACCGCAGACGATCGACGCCGAGAGCGCGCTGCTCGTATCGTCGGCCACGCTTGCAGCGGCGTGGGACACCCACGCCAGTGTC
AACTGCTTGGCCAATAGCGCCATGGCCACGCTCTCGTCCGTCGCCATGCTCGTCGCTGCGTCGCCGTCCTTGGCCTCGGCTGCGAGTACCGTCATCGTAG
CCAGTGGAACGTCGTCCGTGTCTTTCGATTCGTGACGCACGGGCGACCTCGGTACCTCGTGAAACAGCTTTGCAAAGATACCGTCTTTGGCGATCGATGC
AACGATATCCGGGGGTAAAAGAGTACTCGGTGGCGGGGCAAACGACCGCCGCAAGGCCTCGTTGGCCGCCGTCACCATCGCGTCGTCCAGCGCTGAGCTC
ACAATCGCCGTCGCTATCAGCACCTCCCGCGCTACGTCGTCGCGCGTGACCAAGACGGGCTCCTCCGCGGCGCTCACAGCAGAGTTGGCTGCTGTATCGT
TGACAGAACGGGTGGCAAGCTTGGGCTCCTTGCGTGGCGTGGCCTTGCGAGGAGTCGGCGTCTGCCGGGGCGACGGCACCGGTGATCGCCACGCTTCCTT
CCGCGGCGAGCGCGTTGTTGGGGAATGGGCTGGTCGCGGTGACGTCGGTGCTGTTTGGAGGAGGCGCGGCTCGAGGGGCAGTCGCGGCACATCGAGGCTC
GCCGCTGACGCTTGCGTCCTGAGTTTTTCCGTCCCGATTCCTTGCGCCGGCTTGCTTGGCGATTTGATGACTAGACACATGGTCGTCTTCGATGCCAACA
CATTAGATAGCAACGTACGACTGCTCGGCATTGGTCGCACGCGGCTTTTGGTCGGTGATTTCGTCGGTGACGACGACTGGGGTGGCAGCCGCGCGGGCGG
CCGGGGCTTGACCGCTGCCTCCTTTGACGGCGACGGCGCAACAGCCACAGACGTTTTGAGAGGCTTGGCAAACCCGTACGCAGACGTGAGGAGGTTTCCG
CGCACGGCGCGGTCGGCGACTTCTGCTTGCGCCAGCGCGCGCTCCTTGTCCTTTTCGCCAATGCTCGGCATCGGATCGTACACGACGCCGTCCTTGGGCT
CCTTCTTGGGACTGGTCATGACGCGGAGCTTGGTCGTTCGAGTGACTTCTACACGAGTTGGCTGTGAGCCAGTGCAATAGGCTGTTGGAAATCCTACTTT
GTGGCGAGTAGGTGCGGACGCGCTTGACCGGGGACCGCGCGAGCTGCTGGCACACAATGCCCGAGTACTTGAGCACACCTTGTCGCATCTTTAGCGATTT
CAACAGGTATCTCCGCTCATACTTGCATCGGCCGCAAACTGCACCATGGCGTGCGACACAGTCGAGAGCGCGCGGAGCTCGTCGAGGACGTCGGTGACTG
TGCGGTCCATCGACATGAAGCTAGCTCGAGGCGTCAGACAACCAAATATGCTGTCGACATACCAGAGCAGGGCCGTCGTAACCGCAACCGAGACCCGCTT
GGACGCTTCCACGTTGACGCTCGCCTGCAAGAGCTGCACAAGGCTCTGCAGAACAGGCCAGTTCTCGTCTGCACCGGTCGCTTGGCCGCTGAGGATCGTG
CCAATGACGTCTTTGCCTCGGGCTTGGCAAATAGCGACGAGGACTAAAAGATGCCCATCAAGACGCTGTCGATGACAGCAAAGCGGCAGACTCGCGCAGG
TGTAGATGACGGCTTGGTCGGCCGTCTTGTCATTGCGCTGGACGATCGGGCGCACGAGAACGGGAAGAAGCCCGAGCCCGAGGACGATGTCAATGCTGCT
GTCGTCGTGCTGCACGAGCGGCGCGAGGGCCCCCGCCGCCGCCGACTAGCGTCTCTGAGCGTCGTACGATGGAATGAGAACGCCAAGTACCTGAAGAATC
ACGTCGTCCGGGAAGCGTCGCAGCCCGTTGGCGAGCAGCTCGATCGCACCGTTCTCGATCAGCACCCGATGGCTCTCGTCGCACGCGCAAGCCAGCTTGC
GAATGAGCACAAAACCGTACGACTGGATGACGGGCACGGACGCCTTGACGCGCAGCATCGAAAGAATCGTGAGTTCGCCCAAGTGGCGGTGCATCTCGTG
CGCGCCGTCACGGGTCCGAACGAGCTTGAGGAGCACGGCAAACGCCTTCTTCTACAGCAAGGCAATGAGTGCGTGGATCAGCGTCTGGCAGTTGACGTAC
GACAAAGAGCGCCGAGACGTTGTCGGCGAAGAGTGCGTTGAGGATCGAGACGACGTCGTGCAGGTCATCGACGTCGTTTCCGTCGGTGCTCGGCGACTGC
GGGGGCTGGAGGCGCGGCGTAATGCTCTGAAGCACCGCGAGTTCGTTGCTAGCACCCTCCATCTCGCTCCATCGAGAGTACACTGTGAAGAAGAGGAGTT
TCGACCTAAATCAGATGCGCGCTCGAGTTATAAATATAGTTCTCATGAGGGTAGGGTTGCCGACTAACATACAAAGCGTGGCACGCGACCGATACGACCA
ACATACAAAAGACCGATAGCAAAGGACGGCGTCGACCATGCGATGTCGAAGGCGTACTTGCCTCACGCGGTCGGCTTCACCGGTAACTGCGCGGAGTACA
TATCTCAAGTAGATGCAGAACTAAAGCCAATCGCTCTCAAAAGCTTGCATGGCTCGCTCTTTTGTGCTGTGCATGCTGTGCAGGGCTGGCACGAGTCGGC
GCAAGGCTCTGTCGGCGGCTGCAGAGAGGATCAAGTGCAATCTCGTGCCTCTTACACCGGTAGTGCTGCGCCCTAATGGCATTTCTCGGCGCTGTCTCAG
TGTCGCCGTCGTGCTCGACATTGCGGTGCGACTGTCCCAGTCCATTTCGACACACTCGAGCTTGAGCTGTTGCGGCGGAAGGGGCGTCTTTCTCACGTGA
AATAGTGTGTGTACACCAATTCCATTTTCCCGTTTTAAAAAAGCACTTGGGATTTTGTAGGCAATACAAAAACGTGTCGTTTTCCCCCGCCAATCAGAAA
CGCGGAGCGCGCGTTGTGTGTCAAAACAAGTCAGTCGATTGGGGCGGCGATTTGATTGATGGAAGCGAGGGTTACATATCCAAAGTCAATTGGCCCGAGC
GACTCCCACTGCTCGCTGCGTCAGGGACGGCGCCACCTACTTCCTGTACCATAGCCCGCTAGCACACTATATATAAGCCGCGCCGTGGCCACGTTAGCTT
GAGATGCACACCACCCACCCCCGCTCGTCGTCCCGCCCGCCGTCGCCGCCCGCGATGGCCTCGCTCTTCTACAACGAACTCGACTTCCTCGGCCGGTGCG
CACGCGTCGCATGGACCACGTCGCTAACGGTTGCGACTAGGAGCTACGACGGTGCCATGCCCCGTTTGCACGAGCCGGTACGTCACGCGCGTGCGAGGAC
CAACGATCGATGTGTGTGCAATAGGAGCCGACGCCGCCGCCGCCGCGACGCGCCTACTATGAAGAGCCGCCGCGAAGTCTGCCCAAGCCACGCAAGAGCA
GCATCGAGATGTTTCTCTCGCAGAGTCCGTCGCAGCACCTTGGCAACGATTTCCTGCGCCTTGGCCTTGACGAACCGCCGCAGTTTTACCTCAACCCCGA
GCTCGCAACGTTTGGCCCGCCGACGAGCGCCGAGACGACGACGACGACGGATCCGTGGTACCACGAGCGATCGTCGTATGCGCCCGAGCCGGCGCCCATG
TACACGGCGTCGTACGCGCCGACGTCGGCGCCGTCAATGCGATCGCAGCAGTGGTCGCGACCGTCGCCGCCGCTCCCAACCTACCCATCGTCGTCGTCGT
CCTTTCGGCAAAGCGCGCCCCGGTCCGCGCCGCGCTCGTTCCCGCTCGGGAACCGGACCGCGGGGCTCTTTGACTCGCTCAAGTCGCCGCTCAAGCCGTG
CAAGTTTTATGCCCAAGGCCACTGCCGCATGGGCACCAAATGCAAATTTGCGCACCAGCTGCCGACCGCGCCGTCGTCCACCGCGTCGTCGGCCGCGTCG
TTTGAGGACGAGTACGCGTCCTACCCGAGCTTTCGGCCGACGCACCACGCGTCGACGAGCAGCCTGGACGCGGCGTCGCTGCCCGAGCTCTCGCCGAACG
TGGCGCTCACGGTCGACGACCTTGCAGGCCGCGTGTACGCCATGGTACGCCTTTTTTTCTAACGGCTCATCACTATATCCTTGCTGCGTTTAGTCGAAGG
ACCAGAATGGCTGTCGGCTTCTCCAAGAGCAGCTCGACGGCCGGTCGGACCTCTGCGATGTGATTTACGCCGAGGCCGTGCCGCACCTCGTCGATATGAT
GGTCGATCCGTTTGGCAACTACCTCTTCCAGAAGCTGCTCGAGCGCGTGAGCGATGGCCAGCGGCTCGTGATTGTGCAGCACGTGGCGTCGCACCTCGTG
GCCGCGGCGCTCAACTTGCACGGAACGCGGTCGGTGCAAAAGGTGGTCGAAGTCTGTGCGACCGACCGCGCGCTCGCGTCGCTCATCGTGTCGGCGCTCG
ACGACGACGCGGTGCGTCTCTGCATCGACTCGAACGGCAACCACGTGATCCAGCGCGCGCTGCAGTTTTTACCGGCCGAGTTTAACCAGTTTGTATTTGA
CGCGGTCGCGGCCGACTGCACGGTCGTTGGGACGCACCGCCACGGCTGCTGCGTGCTCCAGCGCTGCGTCGACGCGGCCAACGAGAGCCAGAAGCGCGCA
GTGATTGCCCAAGTCGAGCGCCACGCGATGAAGCTCATGCAAGACCCGTATGGCAACTACGTGGTCCAGTACGTCCTCGACGCGTGCCCGAGCGACGAGA
CGGTCGGCGTCATGGCCAAATGCGTCGGCCACCTCTTTGAGCTCTCGGTCCAGAAATTTTCGTCCAACGTCGTGGAGAAGTGCCTCGAGTTGGCGCCGTA
CGAGCTGCGCCAGACGTTTGTCAAGGAGCTCATTGCGTCGCCGCGTATGCAGCGCATGCTCCAGGACCAGTTTGCCAACTATGTGGTCCAGCGCGCGCTC
TCGGTGGCCTCGGACGAGCACTGCCTCGCGCTCGTGCACGCGATCGCGCCGCACTTGCCGTCGATGAAGAACACGTCGGGCGGCCGCCGCATCCAGGCCC
GGATCCTCAAACGCTTCCCGCACATGGTCGAGATGGTGATGCTTGGCGAGACCATGCCGCTCGAGACGCCGCCGCCGCTCTATGGCCGCGTCGCGTAGCG
TCTTTGTATGTACTCTTAGCCGCCACACTAGTTCCAACATCCTGTATCATTAATACCCGACGTACTTCTGTGTCGTTCACGCTCGTCGTAGAATACGCGT
CCTCCACTTGCAGGAAGCGGGGCATGATGAGCTGGCGCTGCTGATGGTACTGGGCACACACGGGTCGGATCGTGTGTCCGCAGTCCGCCCTCTACAACCA
CGACGTGTAATAGGTGTCGTCGTTCTTGGGACCGCGCTACTGCTGTCGTTGCATGCCACGTCGGCGTCGCGTTGGTATTACGCCCACCGTTGCTACCTCG
TGTAGCAGGCTCGTCTCCCAGCGAGGACCGTGCATGGCGCCGCTATGGCCTCTTCCGGCAGTCTCTTCCAGTAGCCTCTTCCGGTAGCCTCTTCCGGCAC
CGCATCCGCGTCCGGCCTTGCGACCGCACCCCGTCCCATGCGCATCGACCTCGGCTCCGTGTCAATGAGTTTCCAACAGGTGTGTTTTAAACACATTGGC
GGCCGGCTGTTTTCAAACGTGCGTGAGTAACGGGCGTCGATGTCACACATTCTCAGTCGAAGGCGCGTGGTTCGACGCAATACAATAGACGCCGTATACA
AATTGCAAGTGAAAATAAAATAAACGGGGACGTGCCCCCTCCAAAACTTCGCCACGTGGTGCGGTTGCAACTGGCCCCTTCTTCGAATCCGTTCGCATCG
CCGCTGCATTTTTAATTGTGTTTATTGTATTAGCTTGCCGTTTGTATTGAACAGCGACACGGGTGCATATTAATAAAAGACAGTGTATGCGAGTTTGCAT
TTTAATACACTGGCTGGCTACTACGGCGATAGGTGTAATCGTGAGACTCCTCATCTCTTGGACTGCCGCGGGTACAGCGGAAGGACGACGACGTAGCCCG
CCGACGCCGACGACGCCCGAACCAACCCCGCCACGCCGCCGGCGACCTCTGCCGACCCGGACCGAATCACATACGTCTACTTCCGCCACGATGGCCAACG
ACATGGAGTCGCTTCACTTGCCCCGCCTCGACCTTGGCATCTTCAAGAGCAGCTGCCGGTACCTCGAGCGCATTGGCAAGCCGTCGATTCCGTTCCAGCC
GCCAACGTGGGCCCTCCCGGCGT