Description :
From Genome Similarity Track
Location :
Scaffold_13:1223188- 1226024
Sequence
2836 bases(100 bases per row)
CGATGAACGCTGGATCCGTGCTCATCGTGCCTTTTCGACCCTGAAGATGAAGATCGCGACGACACCGATCCTGCGGCACTTCGATCGCGATCGGACTCCG
GTCGTGATTGTGTATGCCAGTGACTGGGCGATCTCGGCCGCATTGATGCAGGAGCACGACCAGATCTATCATCCCGTAACTTTCGCCAGTCGAACGCTGA
AGTCGAATGAACTGAATTGCAGTGTGGTGGAGAAAGAAGTGCTGGCGCTGTTACGGATCCTGGACCTGAACTATAACATGCTGGTTGGACGATCCATCCG
GGTCTTGACCCGACACTCGACGTTGGCGTGGCTGTTCCGATCACCCGGTCTTCAAGGCCGATTGGGCCAGTGGGCTGCACTCCTATCGCCCTGGACACTG
GAGATCACGAAGTGCACTAAGGGAGAGGACGAGTTATTGGGGGCGATCGCCGCTAGTATTACGCCTCGATCGGATCTGGACGACGCGTTGATCGCGATCG
CGCCGAAGGAAGAACCCCGGCGGAAGATTCAAGCCCCGATCCCGACGGTGCGTGCGGACGAAGAGCTGCTGGTGATGAGTTTCATGGATCCGCCCGCGTC
AAGCGAGGCGGGGGCGCGTACAGTGCAATCTTGTGAAAGTTACCCGAATGGAGTGTAGTGAAGGCTCGATCCGGCTATGCCGAAGGGCTGACTGTTAACG
AGGCGGAGTATCATGGTCTGTTGTTGGGTTTCGACCTCCTGGACGGCATAGATCGAGGCAGGTTAGTGGTCTGCGGTGACTCCAACCTGGTGATCCGACA
AGTACGGGGCGAGATTGACTGCAAAGCACCTAAGCTGACATTGTTGAAGCAGAAGATGCTGGATCAGCTACGGAACTGGCCAGATCACGAGCTGTTACAA
GTGAAACGAGACTGGAACGGAAGTGCGGACAGCCTGGCCAGTGCAGCACTCCAACGTGAAGGGGGCGCCGTCGTCGAGGAGGACGCCGATCATGGGGATC
TAGTGACACTGAACCGACTTGATGAGATCCTGGTCGTCCGGTCGGATGAGTCGATCGCCCGACTACCGCCGATGACAACCCGATCGGGCACCAGATCACG
GCCGAACCCGACCGTCATGCAGGAGGAGTTCGTGCGAGGGTTGCGGATCGATCGGATTCGTCGAGCACAGGATGAAGAAACGTGGATCGCGGGTATGAAG
AAATATCTGAGGGGAGATGTGGCTGATCTGACACAGGATGAGGCCCGATCCTATGGCAACCTCGCAGCGGACTACGAGATCGACGGTGATAATCTGCTGT
TCTATTGCCCACCCTCCAAGCGATCGGATGCAGATCGAGATGGACTGATGAGACTGGTGGCACCGCCGGAGACGCTACATCAAGACATCTTGCATCACTA
TCACTCCACTCTGGAAGGTGGACACCAAGGGATCGGGCGTACATACCAGCGGATCCGCGATCACTTTCACTGGAGAGGTCTCTTCAGAAGTGTGCAGAAG
TACGTCGGCGAATGTGCCAACTGCGAGACCGGCAAAGGACGACCCACGATCAGGGGCGAGTCGCCGGGAAACATCCAGGCGACATACCCGTTCCAGATCA
TAGCGATGGATCACATACCTTCGCCCAAGTCGTACAAGGGTAATACGGAGCTGTTGATCTGGGTCGATCTGTTCACGGGATACGTGATCGCGAAGGCCAG
TAACTCCAGAACAGCGCGGACAATCGCGGAGTCCTACGAAGAGTGTGTTTTCAGACGATTCGGTGCCAGCGAAGTGATCCGGCACGACCGTGAGCCGGGG
TTCATGTCGGACTTCTTTCGATCCTTCAACCGGATCCTGGGTCAACGAAAACGTGCAACGATGGCATATTGGCCGCAAGCGAATGGAACCGCCGAACGCA
TCATGCAAACAGCAACTCGCGCTCTGAAGATGTATGTGCACGATCTGGATCAGCGCGATTGGGACGATTACGCGGAGCGTCTCACCTTCGCACTTAACAT
TGCCCAAGATCGGATCCGAGGAGAAACGCCATTTTACTTGGTACATGGCTGGGATCCGAGATCCACACTCGAAGCCACAATCCCGGTAGGCAGTACTCGC
CGCCAGGATCGGGATCCACGGCGGTGGAGATACCGGATCCAACGCTATTATGAGCAGGCACGGGCAGAAGTCAACACGCGACTGCAGGGGGCGATCTCAG
ATCGGGCAGACCGGCACAACGAAGAGATCCATCCGCACCAGATTGAGGTAGGATCCAGGGTCTGGCTGTATCTGGACCGGGTGAAGGAAGGGTATGCTCG
CAAATTGGCCCATATGTGGCACGGACCATTCCGTATAGCGGAGAAGATCGGAGAACACGCTGTGCGGATCGAGACTCCAGGCACAGAGTATCGGCTGTTC
CATGTGATGCATGTGTCCAAATTGAAGCTTGCGAGGAGTTTTCTGGATCGACCCCAGATCCAGTTGACTGAAGGCACTACAGATCGATTTGATTTTGATG
AAGCACTGCTGCCAGAGGACAGTTGGATCCAGGATCTGGATGAAAACGAGTACGAGGTGGAGAAAATTACTGACATGTGGACTGGAAAGCGTACTCGTTA
CGGCCGGATCCACCGTGAATTCCTTGTACACTGGCGTGGATATGAAGATCCATCCTGGGTGGACAAGGCGGATCTGAACTGTGGAGCCATACTGCATGAG
TTTTTGCGGGGGCGCTCCAACCGGAACCGGTTTGGGGTAATGTAGTTTCACGAGGAGGTTGAGACTGAGATCCCCAAGAGCGAGTTGGTCGCTCTGTGGA
GGATTTTGACGACGAATCTGCAAGGTGGTTGCAGAT