Description :
From Genome Similarity Track
Location :
Scaffold_1632:1223- 3626
Sequence
2403 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAGTGTCACCTGATTCTCAGG
GATTCGAGTCGGTTCGCAGTCAGTCTGCAATCAAAGTGATGCGTGACCTTGAAGAACCGTTGTGGATGCACAGACTGGATACTTTCGAGGAGTCGAGAGG
GAGTCCTGCACCATACTAAACCAAGTCTAAGGACCCACAATTGGCACTTTCGACGCCGTGCGACAATGGATTCGCAAGCCGATCGCAAGATTGGACCGCT
GATCCCAAGGTATACTCAAGACAAGACATTTTGACCCCAAGCATAGTGAACAGAAGATATTTGCCCGAAGAAGATATATATATATATATATATATAGAGA
GAGAGAGAAGTAGCTGATAAAAGCCAAACAGAGTTCCTTTTACCCTGTACTGCGCAAGTGACTTTGGCCAAGCCTGCCGACGGAAATCCGGAGGACCCGA
GACTACGACCGCGGGACGCTAAGGGCACATCAACGGCGAAGGACAGCCGTCTGTGTGGGCTCCATTAAACTCAAGTCCAGTTAGGTGGTGACCAGCGACG
GCCTTGAGCTTCCTGGGGTGATCCATCTATTCCATATCCTAGTTGGGTCACTTGCTGTGCTCGTGGTAGCCCATTTCATATTATTCCAGAGGGTATTCTG
GGGTGCTAGGCAGTCGCCTCCAGGATTTTGTATTGACTGCTTGTGTGAAGGGAAGGTAACTGATAGTGGTTGTATTTTCCTCCTTTATTGGAGGTGGTGC
GCGTTTGTGTGAGTCTCAGGGGAGCTAGGCCCCTGAATTTCAGACTCGAGTGAGCCTAGTGTGTGTGTGACCCACCGTCCAAGGGTCCAAAAGAATAAGT
GACGGCTAGTTGTAGTGTTTGTATACTCTGTATTTGTTGGTTTTATCGAGCTAGGAGGGCATTTGGGTAAGGTGTCTTCTGAGTTCCAAGTCCCAGAGTT
GACTGAAATCCTGGACCCTGAATTCGTGATATTCTGGGTTTCAGGGGATCTGATTCTCTGGGTTTGCCTTTTGGTGTGGAGGTGCGTTCTGAAGTAGACG
TGCGCTCCCGCACTTCTTCGAGGCTACATTTACAACCGGTGGAGTGCCGTTCCGTCGAAGACAAACGAGCCGACAGGGATTACACAAGGTACCCACGCCA
ACCAAGGAGTGTGATTCTCAGGGTTTAAAGCTTTGCGGCTGCGAATCTCTGGGTCTATCTTCTTGCTGTTGACTCTCAAGTCGATTCTCTGGGTCTACCC
CTC