Description :
From Genome Similarity Track
Location :
Scaffold_130:12227- 17067
Sequence
4840 bases(100 bases per row)
AGCCTAAGTCTCATCCGCTCGTTCTGAGCGTAAATCATTTGAAGGGAAATAGGGAGAAAACCTCCTTCTCTAGATTCGAGAAGTCGAAATGGCGATGAGC
GCCGCTATGCTGCAACCGAGCAGCAGAGAGTTGGCCTAGCCATATCAAAAACTGGGCGACAGAGCCAGAGAGTGGGCTCTGACGTGTGATGCGTCGGTAG
ATACCGCGTTTCCCACGTGGGATTCGCTTAAGAGAGAGATGTCTCGCGTGCTCGCACCGCCTAATTAGGCTTATCGAGTGCTTTCATGCTTCTAATCCTC
CCGATAATGGAAGAAGGAGTTATCGGACTATATCCAAGAGTTGGGAACTATTCTTACTGCTATGCAGTTGGATCCCCTCCCTGGGAAACTTCTTGTCACC
ATTTTTATGAAAAGTCTCCGTACTGGGGTCGCTCGGACCGAAGTTTTTCGTGTTCATCCCTCAACCTTTGAGGAGGCTGTGGACATATCGTTAAACGCCG
AGTTTAATTTCAAAGCGGCGCGCTACGGTACACATGGGCATGCCCAATATTCTTTTAATAGGGCTGAGCCCATGGATGTCAGTCATGCAGACGATGAAGA
AGCCGAGCTTCAAGTTGTGGAACAGAAACGTAAAATCCGTAGATGTTACACGTGCGGAAGCACAAGGCATCTCCGCCCTAACTTTCCACTGCGTAAACCG
CGACAGAGTCGGCCGAGCCGTAATACCGCTCCAAACCAGAAACCTGGTACGTAGCGGGAAAACGTCGACTCCCTGTAGGCGCGGGGCGCCCTACTGGGGA
GGAACTAGGCTTTGGAGAGGCTCGAGGAGGTAGAGCTGAACAAGGCTTAGCCCCAAACGATCTCGTGGACCTTATCACGAAGCGTATATACAAGTCAGGC
TTGTTGGTTGCCTCGGCAACATTTAAGGGCTTTGAAGAGTCGTGGTCAATTTTGATTGACTCTGGAGCATCGAGCATACTGCTGAAGCGCTGAAAGCGCA
TGAAGGTGATGTTATCAATGTGCGTCTAGCAACTGGGGCCCGTGTCAACGTACCCAATGTTCCGTTGAACTTATGTGTAGAGTTTTTAGACTTGACAGCA
TTGAAAGCTGTCTTGTCCTAGATTTGGACTCGAGATACGATCTCATTCTTGGTATGGTCTGGGTTATAGGTCATGAGCCATAGATTCACTGGAGGTCCAA
GAAGTCCAAGACCTTAGGCGCTACGCGCAATGTTTCTAGCGAAGCTTTGGAGAGTCGTGAACCCACCTTTGCTATGCAACAAAAGCACTATGGCGCGATC
CTTTGACAGAAGATGTCAATGTACTGGACATTGGAATGTCTGAGTTAACTAACTCCAATGTGAAAACATGAATTCTGAGCGTAGCTCGTTGAGTATTGTG
ATACGGCGCGTACTCTGTTGAGTGTTACTCGTTGTGATAACGAGTCACTGCATGCTGAAAGCATGGTTGGCCTAGGGCCGAGTTATCAAGGATGTGATTC
CTTTGATGAGTGTGGGGTGACACGGGAACCTAGTGCGGTCGGCCGTAAAGGCACCACACTTAATGTCGGTAATGACATTGTTGGCGAAACGCCATTAAGT
TCAGGGCTAGGCCCGTATAATTTAAGTAGAGTGGCAGTTTTAAATCCACTACGAAACACTTCACCGGATGTCGATAAAGACATCAGCTTTCGTATAGAGG
GTACTACTACTACTAGTATCCACGTTGGAGGGGTGTAAGGTCTCATCGAAAAGACGACCTGGACGCCAGGTGACAACTGTTAAGCGCCAGGCGTCCGTGT
AGTCACATAGTGATAATAGTGATACGCTATATACACTTATCAACGGAGTGACTGGCCAGGTTGAGGGCGATGTTAGCCTAGAAACCCTTCCATCTTTGAA
TGCTCTTTGTGAGCTAAACGAAATATATGATGGCGAATTTAGCCAGGCCTTTAAGACAGGAAATTTATTCGAATTAGTGGTCATTAGACCCGATGTCGAG
TTGAACTCGTCCTCATTAATGAATGAGTCGGTCCTAGAGGACACCAAGGCGGCACTCAGTGCCCGGAGTGAATCTTCGATCCTTAAAGATCCTTTGTATC
CATTCTATCCTTTGGTAAAGGAATTTCAAGATGTGGTGTGTCACAACCCACCATCTGTATTACCTCCCGATAGAGATGTACGTCATGAAAACGACCTAGT
TCCAGGAACTAAATACTGCGTAACACGGCAGTGGCCCTTACCTAAGGAAAAGTGTGATGCAATCGACGATTCCTTTCGTGCTAAGCACGCGGCAGGGATG
GTGCGGGAGAGTAAGCCTCCCCATTCCACACCTACATTTTGTGTCAAAAAGCCTAATGGTAAGTGGCGTATTGTGCACGCTTATAATAAGCTCAATGCTG
CCACTATCCCGGCTCATACACCAATCCCCAGAAAGGATGTTCTTCAGAACAATATGGTGGAATGTACATTGTACAGTGCGCTCGACTAAGTCGATGGTTA
TTACCAGCTGCTCATGCGAGCAAGCGATACTCCGCTAACAGCGGTTAGTACCTCGAGCGGTATGCTCTGGGAGTGGCTCGTTATGCCACAAGGGCTGTCA
AATTCCCCGGCTACTTTTAATCGTCCGGTGACGCAACTATTCAGATCTCACCGAGGCTATGCACAAACGTACTTTGATGACATCTTTGTCCATAGTCGTG
CAACAAACAATCGATCTGATGTGAATAATCACATTGATCATTTACGAGCTGTGCTCGAGTGCATGCGCACAGATAAATTGTATGCAAATGTATCTAAGTG
TATCTTTGGTGCAGAAGAGATTTCCTTTCTGGGGTGCTTTATTGGGAAGCGAGGCCTTCGAGCAGACCCCGCTAAGGTAAGGGCCATAGTCGATTGGCCG
GTTCCAAAGAACCAGAAAGATCTACGTAAGTGGCTTGGCCATGCCAATTACTTGCATAAGTATAGTGCCATTACGCAGATATGGCTCGGCCATTATTCAA
TTTCCTTAAGAAGGATGTGGATTGGTGTTGGGGTAACAACGAACATGATGCTTTTCAAGCAGTCAAGAAAAGTCTCGTTCATGCGTCAATACTGGCTTTG
CCCGATTTTGATCGGCCTTTCAGTGTCGTCTGTGACGCATATGACTTTGCCATAGGCCGTGCTCTGTTACGAACAGATGTAGATGGACGCAAACGCGTCA
TTTCATTCGAATCTCGACAGCTCAAAGCTGCTGAAAAGAACTATCTAGTTCATGACAAAAAGCTACTTGCTATGAAGTACGCTCTAGTTCAGAGTACATC
AGCTTGGCTCAAAGCCATTTGTGATCTATACAGATCATGCATCATTGCGTACTGCGACACAGTCGCCGCATCTCTCTCAGAGAATGGCTCGTTGGATTTC
ATTCTTTACCGAATGTAACTTCGAAGTGAAGTATAATCCAGGAAAGCAAAACGCTTTGGCTGATGCGCTATCGCGCCGACCGGACCATGAGCTTTCTCAC
GTCACTACGCTGTCATCGTTAGTCACTGACTTAATCCGTGCGGCTTATACCAAGAATGAACTATGTGTAGCTTTGCTACGTGCTCTTGGGAGCGAGAAGT
TTAAAGACTCGGACATAGAATTGTCAGCACGTTTACGTGCGAGGCTACATCGATATTCTATCGATAATGGCTTGTTGTGCTATCGCACAGATATTGAGGA
TAACCCTTGTATCGCTGTCCCTCATGATGAGAAGTTGAAGTATAGAATCCTCTATGAGGCACATGATACCGCTTTTTTAAGTGGTCATCTCGGTCGTGAG
AAGACTTATAGCTCAGTGAGCCAGGCTTATTGGTGGCCCAAACTATACAAGTGGGTGAGCACCTATGTGCGTACGTGTGAAACGTGTCAGCGGGTGAAAC
CCTCAATACACGCGGCGGCGCCTCTGGCTAGTCTGCCTGTACCACTGGGTGTTGGGAGTTCATCAGCATGGACTTTGTGTTTAGCCTACTAAAGGATCCG
GATGCAACACAGTTATTGTGGTCTTTGTCGACCGTTTGAGCAAAATGGCTCACTTAGCGGCTGCGCTGGATTCGATTGATGGTGAAGGTACAGCTTTGCT
GTTTATTAATCGCGTGTTTCGAAAACACGGTCTACCATGGCAATTGTCTCTGACAGAAATCCTCTTTTCACGGGTATGTGCTGGAAGTCCATCTTCAAGG
TGTTCGGCACCAGATTAGACATGTCTATAGCGGATCATCCGTAGACCGATGGCCAGAATGAGCGTGTCAATCGCGTCCTCGATGACATTTTGCGCAGTGT
TGCGCTAATACGTCTAAGCGTTGGAGCTCCACGCTCCCTGTTGTTGAGTTTGCGTTGAACAACGCTTTTCATTCCTCTACAGGCTATAATTCGTTCTACG
TGAACGGTCTCACCCACCCTCGTGTTCTGTTAACGCTACCACTATGTGGTTCAATCTTTAGTGGGGGAGAGGTAGCCCGGCTTGCTGATATCAACCCTGC
TACTGTTCAAAACAGGTAGGCGAGTTTCTCGCAACACGATTGAATGTCTTAAGACATGTGCGTGACGAAATGGCTGAAAGCCAAGACCAACAAAACAACA
AGCATATGCTAAAAACAAAGGTTGTATTGAACGTTATGAGGTCGGAGACCAAGTATTACTCAATGCTAAAAACCTACCTACAAATGTAGTGTCCGCTGTC
TTTTAGACAAAGTTGCGTCCGCGCTTCATTGAACCATTCACGGTCGTTGCTAAGAAGGGACTTGCGTATACGCTCAACCTTCCACGCAAATTGCGCACAC
ATCCTGTGCTCTACGTTGGCTTGCTTAAACCGTATCGGGA