Description :
From Genome Similarity Track
Location :
scaffold_18:122202- 125232
Transcript NameFunction/comments
g10195.t1 hypothetical protein PHYSODRAFT_559234

Sequence
3030 bases(100 bases per row)
AGATTACCGCTACGTGCACCTTAATGCGGACAACGCCGGCTACTGCAGCAACTTGGTCATCACGAGCCGCTTCACCGTGTACAACTTCCTGCCCAAGCTG
CTCTTCTACGAGTTCAGCAAGCTGGCCAACGCCTACTTCCTCGTCATCTCCGTCATGCAGACCATCAAGCCCATCTCCAACACGGGCGGCTTCCCGGCGT
CGCTGCCGGCGCTGTCCATTATCGTGCTCATCGACATGTTCTTCGCCTGTCTGGAGGACTACAAGCGCCACAAGGCGGACCATATCGCCAACAACTTGCC
ATGTCTACGCTTCCAGAAGGAGAGCAGGGCGTTCGAGTCCGCCAAGTGGCACATGCTGCAGGTCGGGGACGTGGTGAAAGTGGCGAACCGAGACCCGGTC
CCGGCGGACCTGGTGATTCTAGGAGCCTGTGAGCCCGAGCCGACGAACCCCGCGGGCATTTGCTACGTGGAGACGAAATCGTTGGACGGAGAGACCAATT
TGAAGCTGAGACAGGGACTGGAGGCCACGTACACGGCGCTGCTGAGTGACGCCGCGGTCGGAGACTTGAAGGGGACCGTCGTGTGCGAGACGCCCAACAA
CGCGATCCACCGCTTCAGCGGCTCCATGACGCTCGAGGGGGGCAAGAAGGAGGTCATCACGACAAACGCCATCGTGCTGCGCGGCTCGACGCTGCGCAAC
ACGGAGTACATCTATGGTCTCGTGGTGAACACGGGCCCGGACACGAAGATCATGATGGCCTCGTCGTCCGAGCCCATGAAGTGGAGCAACATGGAGAAGC
GCCTGAACAAGCAGATTCTGTACATTTGTATGCTCATGGTGGCGCTGTGCCTCACGGGCGCAATTTTGTCGACGGTCTGGAACGCTCAAAATCTGGACAA
GGACGCGCACAAGGCCGCGTGGTATTTGTATGATGGCAACTCGACGGCCGTCAAGTCGCCCACGGGGAACTTTTTCATCATGGTGCTCTACTACTTCTTG
CTGCTGAACTCGTTCATCCCCGTGTCGCTGTACGTGAGTATGACGTCCGTGAAGTTCATGCAGTCGTATTTCATGAACAACGACCTGGAAATGTACCACG
ACGAGACGGACACGCCGTGCCAAGTGCGCACGATGTCTCTGAACGAGGAGCTCGGTCAGATCGACTACATTTTCTCAGACAAAACGGGCACCCTGACGTG
CAACATTATGGAGTTCCGCAAGTGCTCCATCAATGGCGTCGCGTATGGCATGGGCGAGACGGAGGTGGGTATTGCAGCCAGGAAGCGACAGCAGGAAGAA
GCACCGATGACGTCCTCGTTTTTTGCAGTAACTCCCGGTGGCGGCTGTGCGGTTCCGATGAGGAAAGACCGCATTGATACTGCGCCGGACTCGAACAATC
CTCCGACGGATCGTGTGGTCAAGGCTCCCTTCGTTAACTACCAGGACGATGCACTGTTCGAAGCGCTGGCGCAGAAGAACAGTGTCCAGGCGAAGTCAAT
CGGGTCATTTTTTGAGCATTTGGCAGTGTGCCACACAGTCATGCCGGAAAAGGCCCCGGACAACAGTCTGCGCTTGAGTGCGTCTTCTCCGGATGAGCAA
GCGCTGGTCGCTGCGGCTGCGTGCTTTGGCTACAAGTTTGTGGCTCGTGGACCTGGTAAGGCGATGGTCGAGTACTTTTCTTGCGTCGATCGCCCAGAAG
AGATGACGTGCAATCAGCCGGTTGCTGATCACCCTGTTGGCGGCTACGAGATCCTGGAGGTACTCGAGTTTAACAGCACACGCAAGCGTATGTCGGTCAT
CCTCAAGGCCCCCCACGGCGAGTTGAAACTGTTCTGCAAGGGAGCGGACACCGTCATGTACGAGCGCTTGAGACCGACGAACGACCCTGCTGTCAAGCAG
ACGCGCAACCTGACGTTGCAGCACATGGAGCAATTTGCGTCGGAGGGTCTGCGAACGCTCGTGATTGGCATGACGGACATTGATCCGGCGTTCTTTGAGT
CGTGGGTGATCCGCTACCGCACAGCCATCAACGATATGCGTCAGATCGACCTGCGTCGCAATGGCGAGGACAATGACATTGATCGGCTGATGGAGGAAAT
TGAGGTGAATCTGGACATTTTAGGTGCGACTGCAATTGAGGACCGGCTGCAGGCAGAAGTCCCTGATACAATTTACAAACTGCGTCAGGCATCCATTAAG
ATCTGGATGCTTACTGGTGACAAGGAGGAGACAGCGATCAACATCGGCTTTGCTTGCCGTCTGCTCGCCTCGGACATCGAGCGGATTGTGATCTCGGCGG
ATACGCACCCGGACTTGGCTAGCATCATGGACGAGCTGGAAGCATACAACCGTGAGGATGACAATGAAGACACTTCGGCGTCGACAGCAGCTGGAGCGCT
TGGTGTATCGGTTTCGTCAGAGGCTCGACACTCGGTCTCGCTTCGGAACCAGCGCAAGCGAATGACCCGCATCGAGAGCATGGCGGAGATGCCAAAACAA
GATTTGGGGCTGGTGATTGATGGCGAAACACTGGAGCTTGCGCTGGAAGAGTGCCCTGAGCTACTACTGAAGGTGGCGGAGAAGTGCGTGGCAGTGATTG
CTTGTCGTGTGTCTCCTGCCCAGAAGGCTCAATTGGTGCGACTGGTTCGTGACAACAACCCTGAAATCCGAACTCTGGCCATCGGTGATGGTGCCAACGA
TGTCTCCATGATTCAAGCCGCACACGTGGGTGTTGGTATATCTGGACAGGAAGGTATGCAGGCTGCGAACTCATCGGACTATGCCATCGCGCAGTTCCGC
TTCCTGTCCCGACTGTTACTCGTCCACGGACGATGGAACTACGTGCGCATGGGCAAGTTGATCCTGTACATTTTCTACAAGAATGTGATTCTGAACCTGA
CGCAGTTCTGGTACATGATCTACACGGGCTACTCGGGACAGAAGTTCTTCCTCGAATGGGGGCTTCAGGGCTACAATCTGCTCTTCACAGCACTACCTAT
CGTACTCGTGAGCACCTTCGAACAGGATGT