Description :
From Genome Similarity Track
Location :
scaffold_1653:1222- 2895
Sequence
1673 bases(100 bases per row)
ACACCAGCAAATGTTTATACAACAATTTTTCAAAACACTTCTCCATCGTTCTCTGGAAATGTATCGCGGCATCGCTACACCCTTGCGGAACACGAGTAGG
GGTGTAAATCTTACTGTCGGTCATATACGACAAGAATTCTTGGCATTCTTGTGCCAAAGGCAACTGCCAAAATCCTTTCAGTAGATCAAATAGGCCAAAG
TGTTTCATTCCGCGGACGTGCTCAGTCAACACCCGTAGGATGGGTATCACACCCGCTGCAGCTTCAGTCACAGCACTCAAAGGTCGATAGTCACTAGTCT
GTCTGTACTCCTCTGACCCCGGCTTCCTTACAGGTAACGCGGCACTAGCCCACCTGCTTTGTGGGTTCTCATAAACCCATCCCATGCGCTCGAGTTCTGC
GTTGAAATCGCGTAAGAATTCCCGCAGGTGCGGTGGATACTGTCGCGGTTTGCATTTCTTTGGTATAGCACCCTCCCGAAGTTTTGTTAGTAGGGTGGCA
CCTTTGCAGGTGGGTCACCACCGAGCTTCAGCCTCCAAATATCAAACATGAACGCAGTATTGCGTAATTCTTCACGCCGCTCTCGGGGGTACCCGTTGGC
AATAGCTGCGTCGATGCAATTCCTCCACAGGATCCTCACGTCGCCGTCGCACTCAATACCAATTGTAAATGAAGCATCCAAGTCAACGGGATCATCATTG
ACTGTATCTTCGTTCACCACCAATTGCTCCAGCTGCCTATCTACGTCAATCCCGAGTGTAGCAAGAACGTCTTTGCCAATGATGAACTCGTCTTCATCTT
CCTCAATAATCAAACATGGCACAGGTTTGGTTAAACGAACTGGACCTGCCGCTGTATTTATTTGCAATCGCACGTCAATCTTGCTCTTAGCTCGAAGAGT
GTGTCCACCAGCTGCCTTGACTGGCACCTCGTCCGTCAAATTCACCAGCGCAACCTTTGCATCCTTCTTCATCAATTCTTCCAACTGCGTCTTACTTATC
ACACTTATATTCGCCCCTGTATCTTCGCAATAGGGCATTGAGTGCACGTCATTCAGCTCTACTAATTTCATAGGGCCTGCCAAACACTCCTTTATGCGCT
TCAACCTTCATTCTTGTCCTGCTTTTTTTCGGTCTGCTTTTTCGCGATTACGTCTTTCATGTTGTTGCCTCAGCAACTGTGTCTTCTCTTCATGAGAAGC
TACCGGACATCGAACGAGCCAATGATCCCCTTTACACTTTAGGCATCCTCCCTCTGGTTTTCTGGCGGGGTGGCCACGGTCAGCGCGTTGTGGCATTTTT
TCTGGCACTCTGGTACCCGCAGATTTGGTAGTTGGTGTAAGCTCGTATGGAGTCGATTCGTTTCGTACAGCACGGGTCTTCTTTCTCGGTGGGTCTGATT
CAACTTGACCTCCACCACGATTCCCCGTTCGTTGACGCTTTCGACGCTGAAAATCTCTTTCATGCTCAAAAGCCTTCTCTAGTATGATCTTGAATAGGGC
TCTCTCATCAGACCTTGCATCCCGATTTTGATATGCTAATATCGCTTCAATGTCCTCACGCAAGGCTTGAGGTTCGATGGATGAGACCAACAGCTTGCAT
TTTAGCTTAAGGCCTTCCTGATCAGTTAAGAACTCCGACCAACCCCGTTCTTCAATCACTTGTCGACTTGACC