Description :
From Genome Similarity Track
Location :
Scaffold_1357:1222- 2351
Transcript NameFunction/comments
Phyke_g11807hypothetical protein

Sequence
1129 bases(100 bases per row)
GCTCGATTCAATGATCAGCTCACGAGCTGACTGGATCCCTGGTTACCGTCATCGAAGTCGGTATACACCAACAGAAGTAACTCCATGGCTTCTGCCCGAC
GTTATGATCACCAGCGTCCGTGAGCTGACCGTCAACACACTTTTCCACCAGTTCAGCAAACCTCCTAACTGGATGTTTCCTTTACGATCTTGGGCACCAC
CGCGATCAACCTGGTCTCCTGATCTCATCACAGAGGCCAACGTACGAAGCATGCTTGCGACTCTCCCCTGGCAGGTGTTGGAGTCGGTTATTGTGCCTCG
GTCGTTTGATCTCTCGGGCTGGTTCGACCAGTTATCCCACAATTATCTGCAACTGGAGGACGAATATCGCCAAGCTTATTGGGAAGCAACCCACGCTCTT
CCGATCACGGCTGATCAGCAAAGAAGCAATGCTTATCTGGCCGCATATTATTTAGAACGCAAGCAGCGTCGATCGCGAGCCGGTGCTCGTTGGAAAACTC
TGCTTCGATTCATTCTGCAAGGAATGATCGCCGGACACTGCGATCTCGATATTCTGCTGGACCCGTTCTTCTTGCATTTTCCATGCCAAGGTGACCACGG
AATCTGGTATCCTGGACTCGGAACTAGTCCGGCGCCAGCAGACCTGattgctgcgcttcaagctgtcgATGTTGGTGAGCCATGGCGCAACCACTTTCGT
GATCGACCCGCTGACCATCCAGCACTCTGCATCGCTTGCTTAGACGGGAAATTCTGGCCTCAGACAGATAGCGATTAAGGTACAGCTAGTAAATAGCTTC
TTGCATATTCCATAACGTCTGCAATCAACCACCACTTGCTTCTTGGTCGACTCTGTTGAGTCTCCTTTTCCTTCGTATCTTATGTAAACTTAAATCGAGA
GGTGATTACGTCCTCTCGATTTAACAACTCACTTCACATGTACATCCCCCACATAATGTGCAGCCTCCCTGCACATCTTCCACTCCACTTTCCCGCAACA
GCCATCCTGCTACGGGCACCTACAGATCCTCTTCGTGAGACTGCATCACGTTGAAACGGCTTCGACTCGCGATCTCCCGTTCATATTCCCGTAATAACGC
ACCACAATTTAGATCAGCTTCGTCTACCC