Description :
From Genome Similarity Track
Location :
scaffold_553:12219- 13868
Transcript NameFunction/comments
Pl_103884hypothetical protein PHYSODRAFT_508397

Sequence
1649 bases(100 bases per row)
GCTGCCGTTCCCGTTGTACTCGGGGTTCTTCCCACAAATGGTGTTGACGGTGGAGGAGCTCATGCACTACCGTCGCTTCGGCAAGGAGCGTGTGGCTCAA
CTCGTGCGTATCATTGACGATGCCGACTGTGTCTACCGTTGGACAGACAGCAAGGCACGCAACGGACGAGGTGTTCAGAAGGCGCAATTCCTGGATATTC
GACCTAATACCAAGCAGCCAGCGTCGCAACAACCGTCCACATTATTCAAGTCCAGTGTTCACATTGTGGACGTGCAGCCGGATGAGATTCTCCAAGTTAT
TGCCAAGGTTAGAACACGGGATGCTCGACGAGCCATGAGTTATCTGCATGGAGACGAGTTTATAGATACACAGACATTGCTGACGTTTCCGACGTCATCG
GAGCATAAGAAGCCCAGTTATTCGTACAGAGCCATCAAGTGGTTTCTCCTCAAGGCGAACAGACGAGAAGGACAGAAAAGTCTGGATTTTTGTTATCTAG
AATATGCAGGCAAGAGGAAGGCACATGCAGCAGCTAGTAGTGTCGTGGGATTCTGTGTACAGGAGTCTATTGCCAGAGATCGAGAAGTACCGACGTTGGA
GAGATATGATATTCTACGAGGACAACTTGTACGCACGGGCATTTTGATCACCAAGACACACCAGTCGAATATTTTGAAGGTTACTGCTATTGCACAGATT
GATGGAGCTATGGTGCCGGCTGCTGTAAGGGTGACAATGGAAGAGATCATGGTAGACTTTGTTGCGGCAGTACATCGGGTCAAGGGGTTACTGGAACGAC
AGCGGATGGGACGATTGCAGTACTTGGATGAATGGGAGTGGATCTCCACAAAGGAACGTAAGGCATGTGCAGTTTGTCTACGTGGATTTTACTTCCGTCG
CAAACACCATTGTGCGACGTGTGGAGAGGTTGTGTGCTCCAATTGTGCCCCGCTACGCGAGCTGGAGGAACCGCTAGATGAACATACACTTAGCATGCGC
GTGTGTTCTGTTTGTATGGCGCAGGCTGGCAGTCATCGGGAGAGCAGCATGTGGTCTGGGGTGACTGAAAGTGAGGATGGAATGCTTGAGACTGCCACAA
CTACGACGAATGTTGGTACAGATACGTATATTGGTGGGCTGCGTTATCCAAAGCACCGAGGGCTGCGAAAAGGAGGAATGGAGGAGTCGTTGCGGGGATC
GTCATCGCAGGCGACCCCCGTGCGTTCGCCACTACCACCATTCCGTCAGCGCCATCACCCTCTTGGTAGCCGCACAAGCGCTCAAGGCATTGGACATGAT
TATGAGTCCGATGGCAGCGGACACTACCCACGAGCATCGTCTGAGTCGGCACGACGGTCTAGTGTATTGCGTCACTCGACGTTATCGACTTCAACCATGT
CAACTCAAGCGAAAAAGGAGGCGCTGGATAAGCTTGTGGAACACGTTCGACAAATTCGTGACACGATCAACGTGGCCATCTCGGAAGCTGAGGAAGAAGA
AGAACGTCACAGTATGCTGCTTGAGAGCGGTCGTGGAGACCCGAATGCTGGTGCAGAGCGGTATGATGAGATTTACGACCGGATTATGAAAATACGTGAA
ACATTGGACATATCTAGCTCGGACTTTGATGCTGTACTCGAGTCCATCG