Description :
From Genome Similarity Track
Location :
scaffold_638:12214- 14002
Transcript NameFunction/comments
g9635.t1 myosin-like protein

Sequence
1788 bases(100 bases per row)
ATACGTACACGGGGCGCATCTGTATCGCTGTGAACCCGTACCAATGGCTGGATCTGTATTCCAAAGCAACAATGGAGAAATTCAGCGACGGCAAGCGCGA
CAACAAGCCTCCGCACGTCTACGCCGTGTCGATGGAGGCCTTTTTCAACATGAGACAGAAGCAGGAGAACCAGAGTATTTTGGTGTCGGGAGAGTCTGGA
GCTGGCAAAACCGAGACGACGAAGATTGTCATGAGCCACTTGGCGGCTCTTGCCACCAACTCGAACTCCAAAGTCATCCAGCAGATTATCCAAGCCAACC
CGTTGCTCGAGTCTTTTGGCAATGCCAAAACTGTGCGCAACGACAATTCCAGTCGTTTCGGTAAATTCACGGAGCTTCAGTTCACCATTGAGGGTCAACT
GATCGGTGCCAGGTCGCGCACGTATCTATTGGAAAAGAGTCGTGTCACAACGCAAGCTGATGGAGAGCGCAATTTCCACATCTTTTACCAATTGTTGGCA
CAACGCAAACAATTTCCGGAACTCGAACTGGATATGGTGAACTCGTTCAAGTACGTGTCGGAACTGGCAGAGGCCCCCGGTGGAGACGAAGAGGGCGATC
TCAGTCGCACACGAGAAGCTCTGGAGCTTGTGGGCATTGAACAGCCGCTGCAACAGGAGATTATCCAGATTTTGGGCGCTGTACTGCATCTGGGTGAAAC
GGAATTCACCACGCGGAATGGAGACGTGGATGCCTCGCAACTGGTGGATTTCAAACACTTTTCTGTCGCTTGTCGTCTTCTCGGTGTTGAGGTGGACGCT
TTGGAGCGTGCAGTGTGCAACCGCAACGTCTTTGTGGGGCGTGAAGTGATTCTCAAGCCGATGACGCATGACCAGGCGGCGGATTGTCGCGATGCACTGG
CGAAAAGTCTGTACTCGAAGCTTTTCTTGTGGCTGGTGGAGCAGATTAACCAGACTATTGGCGTGAATGTCAAGGGCGCCGGCTCTTTTATTGGCATTTT
GGATATCTTCGGTTTCGAGCACTTTGAGACGAACTCGTTCGAGCAGTTCTGCATCAACTACGCCAACGAGAAACTGCAGCAGAAGTTCGTGCAGGATGTG
CTGAAGACGGTGCAGATCGAGTACGAGGAGGAGAACATTTCGTGGTCGCACATTACGTTCGCAGACAACCAGGACGTGCTGAATCTCATCGAAGGCCGCT
TGGGTGTCATCAGCTTCTTGAACGAGGAATCGCTGCTTGCCACCGGCACGGATGCGTCGTTCGCAAGCAAATTGGGAGCCGTGATGGAGAACAACCCGTT
GCTGGAGACCCCTCGTCTCAACAAGTGCGCCTTCTCCGTCTACCACTACGCTGGTAAGGTGACGTACGACGCGACCGGCTTCCTTGACAAGCATCGCGAC
GCTATTCTCCCGGACATCAAGCAGTGCATGAGCAAGTCTAAGCTTAAGATCCTGTCTAAAATGTTCACGGACGATGTGAACGCCAACTCCAGCAGCGCCA
GCACCAGTTCTTCGAATGCCCGTGGCCGAACACGCAGCAGCAGCACTAAGAAGGGAGGTCACGCCCAGACACGCCGGACTACCGTTGGCACACAGTTTAA
GGAGAGTCTGTCGCAACTCATGGAGAAGATCAGCCTCACGGAGGTTCACTACGTGCGATGTCTGAAGCCGAACCCTCTCAAGAGTGCACACTGCTTCGCG
CACGGCGACATCGTAAGCCAACTGCGGTGCGCCGGTGTCATCGAGGCCATCCGTGTGTCTCGCAGCGCATACCCGAGCCGCATGCCCC