Description :
From Genome Similarity Track
Location :
contig_18:122128- 125160
Transcript NameFunction/comments
g4377.t1hypothetical protein

Sequence
3032 bases(100 bases per row)
AGATTACCGCTACGTGCACCTTAATGCGGACAACGCCGGCTACTGCAGCAACTTGGTCATCACGAGCCGCTTCACCGTGTACAACTTCCTGCCCAAGCTG
CTCTTCTACGAGTTCAGCAAGCTGGCCAACGCCTACTTCCTCGTCATCTCCGTCATGCAGACCATCAAGCCCATCTCCAACACGGGCGGCTTCCCGGCGT
CGCTGCCGGCGCTGTCCATTATCGTGCTCATCGACATGTTCTTCGCCTGTCTGGAGGACTACAAGCGCCACAAGGCGGACCATATCGCCAACAACTTGCC
ATGTCTACGCTTCCAGAAGGAGAGCAGGGCGTTCGAGTCCGCCAAGTGGCACATGCTGCAGGTCGGGGACGTGGTGAAAGTGGCGAACCGAGACCCGGTC
CCGGCGGACCTGGTGATTCTAGGAGCCTGTGAGCCCGAGCCGACGAACCCCGCGGGCATTTGCTACGTGGAGACGAAATCGTTGGACGGAGAGACCAATT
TGAAGCTGAGACAGGGACTGGAGGCCACGTACACGGCGCTGCTGAGTGACGCCGCGGTCGGAGACTTGAAGGGGACCGTCGTGTGCGAGACGCCCAACAA
CGCGATCCACCGCTTCAGCGGCTCCATGACGCTCGAGGGGGGCAAGAAGGAGGTCATCACGACAAACGCCATCGTGCTGCGCGGCTCGACGCTGCGCAAC
ACGGAGTACATCTATGGTCTCGTGGTGAACACGGGCCCGGACACGAAGATCATGATGGCCTCGTCGTCCGAGCCCATGAAGTGGAGCAACATGGAGAAGC
GCCTGAACAAGCAGATTCTGTACATTTGTATGCTCATGGTGGCGCTGTGCCTCACGGGCGCAATTTTGTCGACGGTCTGGAACGCTCAAAATCTGGACAA
GGACGCGCACAAGGCCGCGTGGTATTTGTATGATGGCAACTCGACGGCCGTCAAGTCGCCCACGGGGAAGCTTTTTCATCATGGTGCTCTACTACTTTTG
CTGCTGAACTCGTTCATCCCCGTGTCGCTGTACGTGAGTATGACGTCCGTGAAGTTCATGCAGTCGTATTTCATGAACAACGACCTGGAAATGTACCACG
ACGAGACGGACACGCCGTGCCAAGTGCGCACGATGTCTCTGAACGAGGAGCTCGGTCAGATCGACTACATTTTCTCAGACAAGACGGGCACCCTGACGTG
CAACATTATGGAGTTCCGCAAGTGCTCCATCAATGGCGTCGCGTATGGCATGGGCGAGACGGAGGTGGGTATTGCAGCCAGGAAGCGACAGCAGGAAGAA
GCACCGATGACGTCCTCGTTTTTTGCAGTAACTCCCGGTGGCGGCTGTGCGGTTCCGATGAGGAAAGACCGCATTGATACTGCGCCGGACTCGAACAATC
CTCCGACGGATCGTGTGGTCAAGGCTCCCTTCGTTAACTACCAGGACGATGCACTGTTCGAAGCGCTGGCGCAGAAGAACAGTGTCCAGGCGAAGTCAAT
TTTGGGTCATTTTTTGAGCATTTGGCAGTGTGCCACACAGTCATGCCGGAAAAGGCCCCGGACAACAGTCTGCGCTTGAGTGCGTCTTCTCCGGATGAGC
AAGCGCTGGTCGCTGCGGCTGCGTGCTTTGGCTACAAGTTTGTGGCTCGTGGACCTGGTAAGGCGATGGTCGAGTACTTTTCTTGCGTCGATCGCCCAGA
AGAGATGACGTGCAATCAGCCGGTTGCTGATCACCCCGTTGGCGGCTACGAGATCCTGGAGGTACTCGAGTTTAACAGCACACGCAAGCGTATGTCGGTC
ATCCTCAAGGCCCCCCACGGCGAGTTGAAACTGTTCTGCAAGGGAGCGGACACCGTCATGTACGAGCGCTTGAGACCGACGAACGACCCTGCTGTCAAGC
AGACGCGCAACCTGACGTTGCAGCACATGGAGCAATTTGCGTCGGAGGGTCTGCGAACGCTCGTGATTGGCATGACGGACATTGATCCGGCGTTCTTTGA
GTCGTGGGTGATCCGCTACCGCACAGCCATCAACGATATGCGTCAGATCGACCTGCGTCGCAATGGCGAGGACAATGACATTGATCGGCTGATGGAGGAA
ATTGAGGTGAATCTGGACATTTTAGGTGCGACCGCAATTGAGGACCGGCTGCAGGCAGAAGTCCCTGATACAATTTACAAACTGCGTCAGGCATCCATTA
AGATCTGGATGCTTACTGGTGACAAGGAGGAGACAGCGATCAACATCGGCTTTGCTTGCCGTCTGCTCGCCTCGGACATCGAGCGGATTGTGATCTCGGC
GGATACGCACCCGGACTTGGCTAGCATCATGGACGAGCTGGAAGCATACAACCGTGAGGATGACAATGAAGACACTTCGGCGTCGACAGCAGCTGGAGCG
CTTGGTGTATCGGTTTCGTCAGAGGCTCGACACTCGGTCTCGCTTCGGAACCAGCGCAAGCGAATGACCCGCATCGAGAGCATGGCGGAGATGCCAAAAC
AAGATTTGGGGCTGGTGATTGATGGCGAAACACTGGAGCTTGCGCTGGAAGAGTGCCCTGAGCTACTACTGAAGGTGGCGGAGAAGTGCGTGGCAGTGAT
TGCTTGTCGTGTGTCTCCTGCCCAGAAGGCTCAATTGGTGCGACTGGTTCGTGACAACAACCCTGAAATCCGAACTCTGGCCATCGGTGATGGTGCCAAC
GATGTCTCCATGATTCAAGCCGCACACGTGGGTGTTGGTATATCTGGACAGGAAGGTATGCAGGCTGCGAACTCATCGGACTATGCCATCGCGCAGTTCC
GCTTCCTGTCCCGACTGTTACTCGTCCACGGACGATGGAACTACGTGCGCATGGGCAAGTTGATCCTGTACATTTTCTACAAGAATGTGATTCTGAACCT
GACGCAGTTCTGGTACATGATCTACACGGGCTACTCGGGACAGAAGTTCTTCCTCGAATGGGGACTTCAGGGCTACAATCTGCTCTTCACAGCACTACCT
ATCGTACTCGTGAGCACCTTCGAACAGGATGT