Description :
From Genome Similarity Track
Location :
scaffold_10:12211- 29222
Transcript NameFunction/comments
g633.t1 mitochondrial-processing peptidase subunit beta
g634.t1 kinesin heavy chain, putative
g635.t1 hypothetical protein PHYSODRAFT_286438
g636.t1hypothetical protein
g637.t1 protein kinase, putative
g638.t1hypothetical protein

Sequence
17011 bases(100 bases per row)
GAAGACACTGCGTTCGTAGTCGATTCATTTTTCTTTTGCATTCGTTCGTGCTTCTCCCCTGTGGCAAAGTGGCGTACGGCCCGTCCGCCTTCCCAGCCAG
AAAACTCACCTGATTATCTTGTTTCTCAGCCTCTATGCCTCATTCTCCCTTCTTGACAACGGCGGGATGCAGGGGCCACACGACACGCTTAGTATCGCAG
CCAGTACGAGCGACGACGGATGAAGTTGTAGTCCGGCAGCTCGTGGATAGGGCCCGTAGCAGCCAGGGCGTGTTCCTTGTCGTTAACGACCTCGTCAGCC
GTCTTACGGACAGCAGCGGCATCCACAGCGTCGATGCGAGCAAAGATCTCGGCGGGGGTCATGCGGCGGCCGTACGTCAGCATCTGGCGACCGATGTCCT
CGCAGATAGGCGACGAGCCGTCCAGCTGCATCAGCATGTTGGCCTTCAGCTGCGTCTTGGCGCGCTCAACCTCCTCATCGGAAGTCTTGTGCACAAGGCG
CACCAGCGCCTCCATGGTGTACCACGTCAGGTCGTTCAGCTTGTACTTGTCAGCGACAGCGTACACACCGAAGAGACCAGTGTCCTGGTAGCACGTGTTG
AAGGACATGTACGAGTGCGCGAGCTCCTTCTCAGCGACCACCTGGCCCAGCTTGGACGACATGTTCATGCCGGCACCCGAGGTGCGGTCCCAGCTGCCGA
GCAGCGTCTGCATGACCAGGAGGGGGAACGAGTGTTCACTAGTCCAGCTGAAGCCCTCGAAGGCGATGGCGACGTGAGCCAGAGGCATGCTGTCATCCTT
GACGCGCACGTCGGATCCGACGAAACGCACGGGTTCGAGAGTGGGGGCCACGGCGGGGGTCGTGGGCAGGTCGCCGAACGACTTCTGGGCCAGCTCCACA
AGCTGCGAGTGGTCCACAGCACCAGCGCCAGCAATCACCATGCGGGGGGCCGTGTAGTGCGTGGCGATGTAGTCCTGCAGGTCCGACTTCTTGAGGTTAC
GGATCTAGACATACATGACACAATTAGTAAAAGGAGCGAGCAGGATTTCCTATTACTAGCGTCTACATGACGTACGTTTTCAATGGGTCCAAGAATGGTG
CGTCCAAGGCCGTTGCCCATGAAAGCGGTCTCGTGCAGGCGGTCAAAGACGACCTCCTCTTGCTGCTTGTTGACTTCCTCCATCTCACGCAGGATGACGT
CGCGCTCACGCTCGATGGCGGCCTCGTCCAGCTTCGAGTTCTGCAGGATGTCGCTGAGGATGTCCATGGCACGCGGCACGTCCTTCTTGAAGACCTTGGC
GTAGTACACGGTCTGCTCGCGGCTCGTGTAGGCGTTGAGGTGGCCGCCCATGTTCTCGATCTCGAGCTCCAGCTGCTGCTGCGTGCGCTTGCTCGTGCCC
TTGAAGGCCATGTGCTCCAGGAAGTGGGCAGCACCGTTGTTCTGCGCGGTCTCGTAACGGGAGCCGGCGCCGATCCACACGCCCACGGTGGCAGTCTCGC
CGTGCGAGCCTTCGGAGGCCACACGCAGGCCGCTGGGCAGCGTCGTCACCTCAGTGGCCGGCGCGTTGAGCACGTAGGACGGGTAGTTAGACACGGCGGC
CGCTACCGACGACTGCGCGCGGGCGAGCGGCTGGCGCACGAGGTTCAGCTTGGACATCATGTTGCTGACTAGGGAAGGGCGGGGCGCTTGGTGCTGCGAG
CTTCGCTTCCAGGCTACGAATGGGAGACCACCAGTACGCGTTGGAGACCCCACGTTTGGCAGGGGTGATTTTCCTATTTTCAGCCCGGAATTCGCAAATT
TAGAGATGTGTTGGGCACAAAGACGCCGGCCACAATCGCCCCCTTTTCCTCTGAGCCCTCCGAACATTAGATTTACTGAATGCAAGCTGCGGGGTTAAAA
ACGGAGATGTGGGATGGGAAGTGTTGCGCTGATTAGTTACAATAAAGGCTAAAAACCGATAGATAAGAATAAATTCAAATAAAGGTACAGATTCTGGTGG
TGTCTCCACGCCACGGAGCCACTTTCAAGTTGCGAGTTGCACTTGCGACGGCATGGTCACCAAAGATCGGAGTACGGCAGCAATGGACAACAAAGCTCAG
CACTAGTTTCTTTTAATCCAGGTGCAGTTATAGTATTATCGATCCTGGATTGAATGATCCCTACACTCTCTGCAAGTTGTCGCCCTTACGCTGACGTTGC
AGCTCATTTTTGGCAATGATCGCACTTCAACGTCAAGCTAAATCCACACTCCTGTCGTAATTGAACATGCAAACGCAGAAGCTATCGAAATGACGGAGAC
CAGAGGTCCTAGAATTACTGGACGTTCAATCTGGAATCCATGAGGGTATTGCAATTCACGGCTACGTACATGTACATCTCGGTGGAATGGCTGAAATTCT
CCTCACAGCGAGGACACTATCGTACGAGGATACTGGCCTTTTAAAGTATCTACGGCGGCATCGGCTGTATCGGATAGATACTTTTAAGAAGGGGGTCACG
AGGAGCATAACGATAGACAATAAGAGTGGATATTATCCATCAGCTATTTGGTAGCCTGAGGTAGGTACCGTATTGCAGCAGCCGAAAGCGGGGTGCCGAG
CTGCCGAAGAATTGCCACTTGTTGTCCAGGATGCTGGCCAGTTAGCACAACTAACTTAGCAGCAGACAACGGTAGAGTACAAGCACAACAGTACAGTGGA
TCTATTTGGCGACTGGTGAGGATCAGGTCGGAATCAGACACACGCAGCCATCGTCAGCTCAGTGTTAAAAAAAACATGGGATCAGCAGCGGAAACTCGCG
CGGGTATCCGTGTGTGTGCGCGCTTCCGTCCGCAGAACAAGTTGGAGCAGAAGCACGAGGCCGTGGAATGCGTGCGGCAGGAAGACAATAGCGCCGTGCA
CGTGCACAGTGAGGCTCGCGGCGTGTCGGATGATCACACCTTTACCTTCGACCAAGTTTTCGGCACCAAGTCGTCGCAACTGGACGTGTATGAGGCGACG
GCCAAACCACTGGTGGAGTCCGCTCTGCGAGGGTACAACTGCACATGCTTCGTGTACGGCCAGACCGGATCGGGCAAGACCTTCTCCATGGAGGGGGTTC
CAGGCGACAAAGATTACGAAGGGATTATCCCGCGCGTCATGGCCGACATCTTCGACAGTATCGAGAATATGCAGGCAGATCTTGAGTTCATCGCTCGTGT
GTCGTACGTCGAGATTTATATGGAGAAAATCCGTGATCTACTCAAACCTTCGTCGACGAACCTGAATGTTCGTGAAAGTCGCGAACGCGGTGTTTGGATC
GCCGGAGCAACGGAGGTTTGTTGTGCATCTGCGGAAGAAATGCAGTCTGTTATGCGGTTGGGGGGAGCGAACCGCGTTATTTCGTCTACGAGGATGAACA
ACGAGTCCAGTCGAAGTCACTCAGTTTTTATCATCACTATTGAGCAGCGGAACACGGCGACAGGTTCAATGAAGAGTGGAAAACTCTTCCTTGTGGACTT
GGCAGGGTCGGAGAAAGTGGGAAAGACGCATGCTAAAGGGCAGACGTTGAAGGAAGCACAACATATTAACAAGTCACTCAGTGCATTGGGTAGTGTGATG
AATGCACTGACGAGTGGGCACGCCAACACGCACATTCCGTACCGCGACTCGAAGCTGACGCGCCTGTTGCAAGATTCACTCGGAGGTAATTCGGAGACGA
CTCTGCTGGTGTGTGCTAGCTCTAGTAGCTACAACAGTGAAGAAACGATCTCCACTCTCCGATTTGGTACTCGAGCCAAGAACATCAAAAACAAGCCCAA
GGTAAATGAAGAGAGAACGGTGGCAGAGTACAAGATTCTTCTTACTGAGAAGGACAAGCGCATTGCTACGTTGGAGGCCCTACTCCGTGAAAACAAAACT
AGTGATGCCAGTGTGCCGGTGGACTCTACAGCAGAGGAACAGCTGAAGATATTTGCTGCAAAGGTGGAGGAGCTTGAAGATGACCAGGCGTCGAAAGCAG
CAGAACTCTTGAGCCTCGAAGATCGGTGTGTGGAATTGGAAGCAAAGAACAGGCACCTCGAGGAAAAGCAGCGTGAGTTTTCCTCATTTGTTAGTCAAAA
CGAAGACTTTGCGAAGAAGCTGGCATTCCTAGAGAATGACCTTGAAGCAAAGGCCAAAGAATGTGAAGAGCTGAACCAGATGCTGGCGAGACGTCGAAAG
CAGGCGTCCACCGCCGATACACCTCCATTGTCATCAGCTAGCACAGCAGACATTGAAGTGTCTGTACAGGCAACAATTGATGAAGACTGTGAACTGGGCC
CTGAACAGCTCAGTAACATTGATCTCGCTCCATCTACGGTGCCTGCACTGGAGCGTTCACGTGCCTGCAGCTCGGTACTCGACAATGAGTTGCTACGCCA
GCAGCTATCTGCGAAGACTCACGAGCTGAAGATCTGCACGCAACGTGTTAACGAGCTGACGAACGAAATGGCTAAACACCGCAGTGGGTATGACGATCAG
ATAGAGGCGCTGCAAGAAAAATTGCGTGGATACGATATTCATGTTCGCGGGTTGGGAGACCAAACTTCGCAATTGGATTCGCTGGTTGCGAACACGAAAA
TGCTGCGCTCCGTCCGTGGTGGAAGTCAGCCCACTCCATTGGCTGGCCGATCGAGCTCCAATTCGCAAGACTTGAGGCTCGAAACCCAGCGTCAAAACAG
CACTGGGTCAGACAAGCTGCACAACAAGTGGGAAGTGGACGATGAGGTATTCCCTGTTGCACCGATCAATATGGAGTCGGTGGTTGTGAAGCGCTTGATA
AGAAATATGCCGGAGCAAAGCCGAGAGAAGATATCGAAGTGGTTGGGATTCGTGCTGGAAGGACGCGATATTCGCTCAAACTTCCACCCGGAGATTGCAA
TTGAAGGAATCAGCGAGGAGGTTAACCGCGATATGAGGCGGCTAATTGTTCCTTTACTGAAGAACCGCCACGATCTGAAGGTCCAGTCTTATGTCCGCAC
ACGCTACGTACTGGTCTCGGACTTAAAGATCACGCTCGATCACAAGCATAAGGACGAAGTACGTCTTGAAGCTACAGACGATTCTGCTAGTGACGATGGA
ACTACGGAAGGCATGTCGTCGCTGCTTTGGGCTAAAGACCATTTATTCTACGGGCCCCGGAGTGACGCTTCCAGTCCGTCAGTGCTTCACGCAAGCCGAA
CGCTGTCTACGACAAAGGACCGGTTCAAGTCTGTTCCTGTGGATCTAAGTGCCAGTATCATCGAGTCAAAGTCAATGTTGGAGGCACCCCGCAGCGCCCC
GCAGCTAATCCGAAAGCCATCGCTTCCGTTTGATTCGTTCAGTGTGCCTGCTCCTGGATCGAGTCCAAGCAGGGGTGGAGTATTTAGTAGATTGCGTACC
AAGACCGGAGTGGGGGCTATGCTTGGCGACGTCAAGACACGCCTTAATGCCCGCTACCACAAAAATCACGTCCATGAAAACGCGCTGTGCGATGGTTGCG
GTATGAGTCCGATCGTTGGAGGCAAGTGGAAGTGTAACACGTGCGATGACGTTGAGCTGTGCGACGGCTGCTATGCTGCAGGGGTCCATGGTTTTGAGGT
GAGCAACGAACTCTGTCGCCGTGTGGAGCAACTCGCCGTACAGAAGCACCATCTACTTGGTGAGTATCCGGAGCTCCTTGAACTGTTCCGTCGTCATATC
TGCCACGACAATGTCATTCAGTTCCGGCGTGTGGTGAAATGGCTTTGTGCTATCGTTTCGGGCGCTCGCACAAAGAAGGTCTACCACAAGATGATCGTGA
AAAGTGGTCTCCACCCTGACATTCGAGCGCGGTTAGTGGCGCAGCTTGGGGCTTTGGCCAGTGAACGTGCAGATATTTCGCTGAAAACCGAGTGGTTTGC
TGAGAAGACGCTCGAGGAAGAAGCAGCCGACTCGGACAACGAGGTATCGGAGTCTAGGCTTGTGGAGCTGGACGGGGACAAACTGTCGCCGGCGGAGGCC
TTCACGTCTCCAAACGTGCGATTGGAGACACTGCGGATGTATCTGATGGACGCATCCAGCTCCAAGTCGGGAAGTGAAGTTGAGGCGTCCACTGCACTCT
CTGACTTGTTAGACCCCTCAGTTAAAGTCAACTCCGATGCTGCGCAGGCCCCGAACTTACGACGAACCCTGAGCGCCACACATGATTCCGCAGGGGGAGA
CCGTGCAGGTCCGTTGCCAGACTTGCGTCGCCAGCAGTCGCTAGATGCGGTGAACCTGCCCACGCATGGCCACCAGCGCGTCAAATCGGTCACCCGGCTG
AATATGTAAGGACACTTCCATCCTGAGTATCAGCAGGCTGGACTGCGTGCGTAGTAGTAGATTTCTTCGACTGGTACATGTACTGTGATTCATGGTGTGG
ATGAATGGAATCATCATGATTCAACCCTGTGATTCATGTAAACTTCGTATTGGTGGTGGTCCACCACTGGTGATACGAAAGCGCAGCGCGAAGAAATGCT
GCCAAAAATGTGACGGGCCTTCGACTCGTCACATTTGATCTTTGCCGTACCACCAGTGCTGCTGTATCGCCACCCCTGGCATGCTTTTCGTCATGAAGTT
CATGCTTTAGCTCGAGGAATGCGTCACCTCATGACTCACTGTCTGTGTCATTTCTGCTTGGCGCGTCAAATCATCCTCTGGGATCATGTCTGAGTTCGTC
TTTCGTCAATGATGCGAATGCACAGATCCAAGGCTGCTAGACTTTTGGAATCCTAATTGGATGGACTCGAGGCTGATACGCTGACTGTCGTCAGCAGCCA
GCACTAGCGCAACTACGTACGCGAGTGTGCTGAGCGTCACGAAATTATGATAGTCCCCAGTACAGTGCATGTACAAAGCACACAGAGCACTACGAACCGC
CTACGATAAGTTATCCCCTCCACGAAACATAATAAAAAAAAAAACTGATACATTTACCAACACCCTAGCTCGTATCTCGTTTTATTCCTCCGAGATGCAG
AGCAAATGGCGACGACAGTTTAGGAAAGGGGTGGTTGAGAGGACGGACGCCTCGATATCTTCAGCGGAACCAGCAGGACGGCCGACAGTCAGTGGACTGG
ATACGCAATGTGCTTCAAGGACTGGCCTTACTGCACTCAGCCACGAATTCGCGCTGTTGCGTGGAGAGGCCCCACACAGGCGCGCCTCGGATAAGCAGCC
GCTGGATAAGCGTCTCTTCCTCGCTGGCGATCCGCGCCAGCGCCTTCTTCTGCTCCTCGGCAGCAAGCGAGGCCTTCTGCGACTCCCACTGCTTCATGAG
CTGCTGCAGCTTGGTCAGATCCTGCGGCTCGGCGCGTGCGCCAGGGTGGAACTTGGAGTTGGCCTCAGAGCGCGTCTTGGCCGAGCCGTAGAAGCCGCCC
TGACCCTCGGAGGGCTGGCCGCCCGAGTACGTCGTGAGAGCGCGAGCAGAGCGCACACGTCCAGCGAAAGCAGAGCGACGACAGGTGTTCAGCACGGCAG
TCTGCATGATAAAAGTTCTTGAAGGCTTGGGGCGGAGACACACGGCAAAAGCGGAAATGGCGAGCAGGTGCCGTTGGCCGTCGAAGGGCGCTGACGTTGC
CGCAAGATTCGAGCGCGATGGGATGTGGATGTACGCTCGCATAGCACCAGAATTCACGTTTTGAACACAGAAATAGGCGATAGGCCCATCCCTTGCACAT
CAATTTCGGTCGGAAGGTCCTGGTTTTGTGCTATTCTAGGATCTCGACCAATCAACCGCGTCTGACGCGCAGGGTGTGGACCGCTTCGAATGCGTCACGC
CTGCGCTTGTCTCATTCCAGCCCAAATTGGGAGCAAAATTAAGAAATGAGCACTTTGAATCATATTTTGATGGTGCAAGTGAGAGATGCAATGGGCTGAC
AAATGGGCATCTCTTTGTCTCACTCAGCGTACAGCATTTACATGTCTTGATGGACTACTATCGACTTCCCCTGACGAGTTGCATATATCATACGTCATTT
CCTATTCAAATGTGTCGTTGAACTTCTCTGGAGCTTTCGTAGCTGATTTGACTTCAACATCATTTTTCTGCTTGGGAATTTGGGATCCAGACCCAAAATC
TGGTCAGTTCGTACCCAAATGCGCACGTAGTGATGCGTCGACAAAGGATTGGCTTGAAGTTGCCAGCCGCCCGAGTGTCATGTCCAAGGCTCCCCCACCG
TCGGTGGCGCAGGCGTCACCAAGCTTCTCGAGGAATTACGTGACACTCGCTGTGCTGTCTGCCGTCGTGGCAGTACTCGTGGCCGCCTGGACGTCACATG
ATTGGACTTTCAAACGCGAAGGTGTCTCCATTGAGTCCTCGACTGGCAATGCGTCTGCATCGCTGGTGGACAAGTACAATAGCGACGTGGTGAGGATCTT
TACGCACCCGTTGCTGGTAGACGCAATGTCCGATCTCAAATGCCCGGACTTTCAACCGACCGCCGAAGGTTTGACGCACGTGGAGCTGGTGCTGGGGCAT
GAGCAACAGCTACGAGACCGGAACCAGGTCTTCTTCATGTTGAACGGACAGAACGAGGGGGTTTACATGCCTTGGACGCACCAACCTACCGGACAAGCGT
GCATCTTGGAGCTGACACAGACGGCAGCGCTGAATCTCGGAGCGGATCCGGACTTGCTAGCCAATGGGGTAAAGCTCCTCTCAGTCGATGGCTTGCCGAT
CCTCAATGCGGATGAATTGGACGTAAAGCGTATTGCTCACGTACTGCTGGATGGGCAACTCTGGGTCTGGCCTGGGATCAAGGTGGGATACAAACGGGAG
ATCGAAGGCTGCACCGTTACAACGCAGTCGCTTCATCCGAAGGTGTTCACTGTGGAAGGTTTTTTCACGCAGGAGGAAGCGGATGCGATTATTGCTGAGG
GTGTCGATCACCTCTCTCGCTCTCCGGTCGACAGCCCCAACGCAGAGGACGGATATCACGTCGATAGAACGAGCTTCACAGCGTTCCTGGACGACAGCAA
CTTTACTAGGGACTTTCGCGTGCGGTCATCACGCCTGGCTCGACTTCCGTCTCCTAGTTATACCGAGAGGATGCAACTTGTGCGATACGAAACTGGTCAA
TTTTTCCGCAAACACGAGGATTACTTCGACTCAAAGGAGTTCGTACCGACCAAATATTTCGCCGCCGGCCAATTTGAGGAGTGGATTAACTGGGCATCGT
CCAAAATCAATCAATTGCGACAGGAACATGTTGACAATATCGTCCCTGTGGAGTTCCTGCCAGAAGGTGAGATGTACCCCGATATTCAAAGCACAACAAC
GTTTCATCACGCGCTACTCAAGGGCTTCATGGAAGATGCTGAGGTGAGCAACTTCTTCTGGGAACATGCCGACTTGGAGTGGAGGGATTGGATTGCTGAA
AATCTTGATCGAGCAGCAGACAATATCATGGGTCCGATCTTGGAGAGCAAAGGTTACATGCTGCCATTCATTGTGGCGTCATGGGCGAAGCGAGCTGGCC
ATTCTGAGCTCGTTTATTCATTTCCGAAAGCCCCTATCAGTGGCGTTTCCCACTACTTCAGATGGATACAATGGTCAAAGGAACGCGTGCAAACTCTGAT
GGATACGCAGCCAGAAGCTGTTCCAAAGCGCGTGAGACCTGAAGGTGAAGATTATCCGACATTTTACATGAGCTTTCAAAGCCGCGTGGCTAGGCATATT
CTCGAAGACTATAGCCGCGAATTTCTTGTCGAGACGCTCACCGGAGATTTCTACGCGTGGCTTGTTGACAACAAAGATAACGATGACGTTATACTGGAGC
TTCTTCGTAGCAATCCCTCTACGTTCGACCTTGTCGTAGAGTCCTGGACCAAGCGCGCTGGCGATCTATTCACCTACGAGAAGCCAAAGTATCTGCACCA
TTTCGAACCGAATCGCTTCGCGACGCTGTTTCTGTATCTAAACGATTGCCCTGAGGGTGGCGAGACGGTGTTCCCGTACTCGAAGGAGCGACTGGTGACT
GGAATCAAGCGGGAGGGTATGGAAGAGTGCTCTGATGGTCTTGCGGTGCCGCCTGTGAAGCTTACGGCTTCGTTATTTTACTCTCAGACGCCAGTGAATG
GATTGGACCCAGCAAGTCTTCACGGTGGTTGCCCACCAGCAAAAGGTGTCAAATGTACGTCGGTATAATTCTTTATTTTGTGCTGAAAACTTCAACTAAC
CAACAAATTCTTTTGCTGTAGTCGGGGCTAACTCCTTCATGTGGAATGCTGATGCGGACGAGGGTGCAAACGCTTGGGGCATGGGCGAAGACTTTAAAAC
GATGTCAACAGTATCGCAACAATAATAAAATACTATATAAATACGATACAAATTCCTGCGTCAAGTCTATAAAAAAAGCGACCAAGACAGCAGAAGACTG
CACCCCTCAATTCGACACGATGGGCCACACAGCTAGCGTGCATCGGCAGCGACGTAGCTCGACAGGCACGCTGTATGGAGAACCCGCAGGCGCATCTGCA
GCGCCACGTGGGAGCTACACGCCTGCGCAGATGCAGGCGCTGTATCTGAGTCGAGGAAGGCCGGACATGGCCTTCATGTCGAACCAGGGCCGCACCCCCG
TCGACGTCCCCGAGCTACAGCAGACGTGTACGGTGAGGAATCACGTGAACCTCAAGAAGACCAGTCTCAAGCTGCAGCAGTCGCCCACAGAGGGGCAGCA
GTACGCTCTGGAATTCCAATTCGACGCCACCAAACCATGTGACATCAGTGTCTATTTGGTGGCATCAGAGACCGTCGACGCCGACAGTGGCGGGTCCAGC
TTCGCGCTGGTTCATACAGACAATAACCCGGTACTTACTCGGCACTTCAAGTCAGGTTTAGGACAGACCTTCGTTCTTAAAGGGGGCGAGAAGGATGAGA
CTGCCGCGGATACCGAGGAAGAGAACCACGAGGAGCCCTTACCACTCTTGGACTTCTCGCCATACAGTCCGGATGAACTGGTGTACAAACCCGGCACGAC
GCAGTTTCCGTTGATCGTTGTGCTTGAAGTATCTTCAACCAGTGAGTGTGTATTGAGCGATTTCCGAACTTTCCTTCTGCTTATTTGTTGTGGTTGTTGA
TAGGGAAAAGCCCGCAATCTCAGTCGACATTCTGCACATTCGTCAAGAAAGGAGACGAACTGTGGGATATCAAGATGCTCAAGCAGAAAATCTTGGCAAG
AATAGTTGTCGGAGCGCCATCAGAAATGCTAGAGCTGACTCTTGTGTCTGTTTCACTTGTTTAGGTTGAAGGGTTGACGTACGAGTTGCAGGAGATCTAC
GGCATTGATGGATCAGTGGCGGCAGCACCGAAGACTGAGAGGAATGGTGCAGCCGGCGATGACCAAGCTGGCATGACGCAGACAGCCAAAGATGAGATTG
AAATCTCTGAAGGTGCTGAGTGCATTATCTGCTTGTGTGAACCGCGTAACACTACAGTTCTTCCCTGTCGGCACATGTGCCTCTGCAGCGAGTGCGCTGA
AGCATTACGCAAGAGCTCTAGCACGTGTCCCATTTGTCGGACACCCGTTGAGGCATTGCTTCAGATTCGAGTCGAGGCAAAGGAGACCACGACGACAGAA
GCAGAGGACGACAAGACTGAAGTGGAAGATGTCGAGTGATAATAAGCGACGCAAGCCAATTATGACAAGAAACATAAAACTATTCTTTGACAATAACTGT
GAATGCTAACAACATGATGAATAAAGTAGTACTTCAAAAGTACTTGATGTACATGTACAACTCATCGAAAGCTTAGCAGCACAATTGACAAATTCATCTG
AAGCATAACGAAAGAAATTTATCAAATTACTGGTTCCTTCCTACCTCATCCTTGTCCTTTCGATGCGTGACGGACCACCAGAATCAAAAGTTACCCCTCG
GCTTCCGATCTAGCGAGCCCTTCAACACATCAAAAAGATTCTCTATCCGTGCAGACCTCGTCTTTGCTAGTGACACGTTGCCGCGCACGGTCCTGTAGCT
GGCTGGGTTCCGCGCGCTTGATTTTTCTTGTTCGTTTTTGGTTGATTATCTTGTACAAATACTGGCGGCGCCTGACGGTGCGTGTTTGGCGGTGAAAAGA
CTCGACAAAAAGGGTTTGTTCGCAAAGCTTCCGCCCTTCATTGTCGATTAGTTACACCAAAACACATGCAGATAATACGTTACTGTCGCACCGCATCCCC
TCCGCTGCCATCGCCTGTGCTCGTGCTCCGTCCTGCAGACTATTTAGTCGATGCCATTCTCGTTAGGTCCCAAGCTCTCGGGGCTGCCTAACACCAGCTA
ATTGTTCTTCCTCCACATTCCCTTCATCTGCCAACGTTCAAAACACCAAAGTCATTTAGAGAAATCAACACCGGAGTGCACTCACCAAGTTCGGACCTTT
TTCATAGATAAACGACTTACCAAGTTGGCGACTTGTTCGGGGGCGTCACGGAGTCGATTGGCCGTCGACGGAGTCGAGCTGACATCACCCGGTGAGCCGT
AGTAAGGGCTGCCCTGGCCTTTGGCAGGATAACCCCGCTGAGATCTTGTCTGCTGAACTTCCTCTGCAGCGACTTTGGCATTCAGGTCACCTGAAGACTG
CGACTGCATATCAGCTAGATTAGGCTGCCGTCCGCCACGCCCGGGCGGACTGCCACCGTTGTTGTCTCCCCGTCGGCTAGGGCTTTCACCTCCGTGGTTA
AAGTTGTTGTCTGCGCTGGAATTTGAGTCATCCGAAGTTGTAGGAGATCCGACCTTAGCCGCGTTGTACGACAGTTTGCGCGTCATCATTTCTACCATTT
GCTCCCGCTTCTTCAGTTCACTTTCCCGGCGCATGTAATCCACCTCCAGCTCTGCAAAGAAATACAAATGCATCGTAAGACCCCATCCGTATAAATACTA
CTGAAATACCAGTTTGCCATACCTTTCAGCTTCTTCTCCCGAGCCATCAAGGCTGCCTCCTGTCGACGAAGGTCCTCTTCAATGCCCAATAGCTCCTTCA
TTTTCTGATTGTAGGAAGTCTGCAGGTTCGGATCGGCAGCCGGCTGCGGGGCATTGGCCGCTGTGTATGCACGTAATCTCTGTTGCAGCTGCGGAACACG
CTCCAAATCTTCAATTCTCGGTCGCCGAGAGCGTTGTCTGTGGAGCATCCATCGAATGACCTGGAAAAGGCCCTCCGAGTACTGCGACGGGATACGCGTG
AACTTGCCTGCGTTAATCTTTTTTGCCAGTGCGAGCTGATTCGTCGCATCGAAAGGGGGGCCGAGCGTGGCCATCTCATACAGCAAACATCCCAGCGCCC
AAATGTCGGAACGGTCGTCGTAAGTCATCTCGTTCACCATCTCCGGACTCATGTAGTAAGGAGTTCCGACATTCGTCTGGGCAAAACGAGACTCGCTGCT
GAGCTCTTTGGCGAGTCCGAAGTCGCCAAGCTTGGCATTGTTCTGGAGAGAGAAATAAAGGAAAAACCTGTCAGAAAGCCATACACAGGTTCGAAAAAGA
CAAGGAAAAAAACACCGTACGTTGGAGTCTAAGAAAATGTTGCCAGGCTTGATGTCACGGTGGAGAATGGGACGGATGGCGTTGCCTTCGCGGTGACGGT
GGCACTCCTTCAGTGCCAGGAAAATGTGCGTGAAAATGTGCCAGATAAAGCCCTCTTCGATGTAGGACCTATAGACGAAAACCAATTCAACCAAAAAGTC
AGAAATCGATCAGAGATTCCGAAATGATACAAGATGCTGCTCTTGGGATAGGCATCGATTGTGGCGTACCCCTCTCGTTTCTTCCTCTTGATGAACTGGC
CGAGGTCACCGCCCTCGCAGTATTCCATGACGATGTAGATCTTGGTGGCCTGCTTGTCGATCACTCGGTCCAGGTAGCGGACGATGTGCGGGTGGCGCAA
TTCCCTGAGGATGTTGACCTGTAGCACAAAAATTAAAGTCAGAATATCCACCTTTGAACTCCCAGCAGCAGCTCTAGACGTCTACGCACCTCGGACACAA
TAAGCTGCTTTTCCTTCTCACTCATGGCGCCGTAGTTCACTTCCTTCCACACTAGCATCTGCTCAATTCAGTACAAGTTAGTACGTATTCGCACTGTTGG
TCCAGTACCTGGTGCTCACCTTGCGGTCGGCCTTGCGCACGATCTGCGTGACGACGCCGAACGAGCCCTTGCCGATGATGCGGACCTGCTCGTACGCGTC
CATGTTGGGCTAGCTGGTGCTGTGCGGTGGGGGGAGGGAGGTTCTCTGCGTAGGAGAAGTGGAGGGGAGACTGTTCCTGTAACGCGAGAGACTGAGGCGA
GTTCGCGGCGAGGAGGAGCGACTGTCGTAGTGACTGGTCGACCCAAACGCTGCAGGACTTCTCTCCTCTCCGCTGTTCTTCGGTTTGTGGCCTGCTCCTT
GCAATTTATCGCCACGGCAAACGCCAGCCAAACTCTCCCCCTTTTGTGTAGTCCAGGTAGTCAAAATGCGCTCCCCTTTTCCACGCCACATACTAAAATC
AAGTCTCCAAGGAATCTGGGCAAATTGGTCCTATCCGTCATATGGCTAAATTTCTAGAGAAACAATTCTAGGTTCACAGAAAACGAGGCTTCCACGCATC
TTACTAACCACCGGGATGCTCATTGCAGTACACTGATTTCAAAGAGCTAAAGATTTAGTGATCATTTCGAATGATCTAGCGTTTCCTGTCGTTTCAGACG
GTCTGTTTACAACGCCACACTGGCACTGTACTGCCGTGTCTGTTCGATTTGACTACCCAGATGCATTTTCCGGTATAGGCAAGTCAGATCAAAAAGCCAG
CCCCGCGTGGCCAGGCAGTATTGTGCAAGAGCCCACACACCGGAGGCGGAAAGAAAGTCGAGGTCGCTCCTCGTGCTTTTCAGGGCGTCGTGCTTGCAGA
CGATCGCTGCTTCACGCTCTGAGCACATACACATCTGTCAGTTCGAAGACGATTATTTTTTTTTTATCTTTGGCTCAAGGTTGAAGATGATAACACAGCA
GTACGCTGAATGGCTACATGTACAGTCTTCCTGCCGTTTTTTAGTGCTCCGCAGCCAGTAACGCCTCCTGGTCGAGCGCGTCCTCGTCCAGCATTAGCGA
GATCCTTCGCTTCTTAGCGTTCGTATGGTTTAGGATGGATCCGTTTTGGTAGTCCACCACGTTCAAGGCGATGCCCACGAGGCTGCCCAGCACGCCGAAC
GATACGAACAACAGCTCAACCCCCGGAATGTACCGGTCGTCGTGGTTAAATTCGGCTGCCACTGCCAGCGGGAACAGCGCAAGCCCAATGTTCTGGAAAG
ATATGCTGGTTAGATTCAAGTGCCAAAGCTATCGCCAATAAAAAATTGGCCGCACCTGGATGGCAGTGATCGCTCCGTACGCGGTTCCAACATGCTTTGC
CTCGACCACGTCTGCAAAGGCAAGAGCCACAGTTAGAAAGCCTTTTAAAAGCTCACAAAAGCCTCTGCAACAAACTTACATGGAACAGAAGGCCATAATG
CTGCTGCAAACACGCTGTAGGCGAGGCCTTGCAGTACCAGCGGCACGTAAAGAGAAACTTGAGTCAATCCAAGCATGACGTGGACTGCTGTCAGTGCCAG
TGGTGCCACCAGTGCCAAAAAAGCTCGAAGACCGATCCGATCCACCACGAACCCGAGGAACGGAGAGATAACAGCACTGATAATGTACGGGATGGACATG
GGGGTAGCGGCCTTCTTGGCCGCGTCGGTTTTCGTGGCACAGTAAGTCCTCGTCAACGGTCCAAATTGCCAAGCTTCGTCATCGCAATTGATCTTGTCGC
CAAGAATCAGCGGGGGTGAAGTGGAGCAGTTCCACTGGTCCAGCGGTTCTTTAATGGTGCAGTTCGCCGACAGCAAAGGGAGGGGCCACCCATAGGGAGG
AGCGTTGGGGCATCCCGGGACGATTTCTCGGCAATCGATTTCAAAACTATAGAAACCCTCTCCACATCTGCGGCAAGGCTCAGGGGGCTCCTTGAAGAAA
TCGCGCTCCATTAAGAGGCTGCTGGCGACGTTGTTGAAGGGAATGACACAGCCGTAGACCACCAGGCAACTTAGCGCCAACAGCCAAAAGGCGGGACGAA
AATGCTTCACATCACTGAAGTGAATGCTCTCCGCTGCAACCACCCCCTCTTTCTGGTTTTCTTTCGCCATCTTTTCAGCTCTTTTATCGATCGGAATCAC
CAGTAAAACGGTGAAAGTGGAGGCGATACACATGATGACACCCACCCAGAGCGCTGCCGAGACATTTGACGCTTCAGCGACAACTGGACTGAGCTCGTTG
TTGATGACACTCCCCAGTCGAGCTACACTAAGATTGATGCCCAAAGCGAGTGCAAGTTCACTGTTTTTGAACCACGAGGCGACGAGCGTTCCCTGTGCCA
CACCCAAACTTTCTCCACCGAAACCAAACACAACTCGACCAAACTGCAATATTAAAAAAGAAACGTTAGTCCTCCTCTATAGATCACCAACGCAAGAGAA
CATCGATCACATTACCAGCATCATGTTGAAGCTAGAGAGCGAACAGCCTGTTGCAAAGATCAACTGTCCTGCTAAGATCGCCGTCGAGAAGGCGAAAAGC
ATCACCCGCGCGCCAAATCGATCGACCAATACACCGCCGAAGAATGGCAGCAGGATATTGGGGATCGAGTACAACGTGTACAGCAGGTTCTACAGTCAAA
ACAAGCACCAATAGTTATTATCTGCTATTTGGAACACAACTATCTTCTGTTGGTGGCGAACGTACGAACAAAAACTCATAGCGATCCTTCGGGATGTTGC
TGAAGTGCTGCTGGAGCTGGCTCTTGAGCGCCGCAGGGTTGTCGAAGCAGTAGTAGTTGCCGATCATCAACACACACGACAGGAACAGCACCAGCCAGCG
CACGCGCAGCTCGCTCTTGTCTGCCATGGCTGCTCACTCTTTTCGGGGGAAAGGATGTGGATACAAAGTCTGAGTCAGACTCAGATTTGATGAATATTCG
CATAAGTACGA