Description :
From Genome Similarity Track
Location :
Scaffold_2250:1221- 4192
Transcript NameFunction/comments
Phypl_g14866hypothetical protein

Sequence
2971 bases(100 bases per row)
ACCGTCGCGTTCTCGCAGCTGTATCGATACGCCACCGTCACGGACAAGGCTCTGCTTGCTCTgggcgtcgtcatggccgGAATTGGCGGCGCACTCTTCC
CGTGCATGGCTCTTGTGTTCGGTGACGCCATCAACTCGTTCGCTCAAGCGGACGGTGGCGTCGACCGAGATGCAGTGAACGCTGCAGcgttcgacttctt
cctcaTCTCCATTGCCCTGTTCGTGACCGACTATTCCTCGGGTGTGCTCTTCGCCTACACGGCGGAGCGACAGATGAAGGAGTTGCGGACCGAGGTGCTT
CGTCACCTGCTGTACCTGGACATCAGTTGGTACGACAAGATCGAGCCGCTGCAATTGTCGAGTCGACTGACGGGCGACACGGTCAAGGTAAAAGACGGCA
TGGGCCAGAAGCTCGGCGACGCCGTCCGCTTCATCTGCCAGTTTTTCTCCGGATACGTCATTGGCTTTGCACGCGGGTGGGATATCACGCTTCTCATGTC
CTGCGTGATGCCGTTCATGGTCGGGTCCATGGGCGTCCTGCTCAAGATCATGCAGAAGCGAGCGGTGCACTCGCAGCAAATGTACGCGgaggctggagct
gtcgcggaggagacgctcgGCTCCATCCGCACAGTGTCATCGCTTAATGCGGAGAAGAGGGCGATCGCCAAGTACAACGAGcgtgcgctggctgcagaAG
AGATCAACATCCAAGTGGGCAAGTTGTCGTCCATTGCCTTCGGGTTCTTCATCGGCTGTGTCTGGCTCATGTACGCTGTCGGTCTCTGGTACGGCGGGTC
CAAGGTGGCACGTGACAAGGCGACGCCTTCGGACGTGTTTCAAGCATTCTTTGGCGTCCTCATGGGCACCATGTCCCTCGGTCAGATCAAACCCAACGTT
TCAGCCATCGCAGAGGCGAAGGGCGCCGCTGCAGAGATCTACAAGGTCCTGGACACGCCTTCTGCAATTGACGCCTCGGACGACCGCCTCGGGGATAAAC
CCGAGTCGTGTATTGGCCGCATTCAAGCTGTGGGCGTCAACTTCACGTACCCCAGTCGACCGGACGTGCAAATTCTGAACGACTACAACGTCACCATCGA
GCCCGGCCAGACTGTCGCGTTCGTGGGGgccagtggcggcggcaagagcACTCTGATCGGGTTGCTCGAGCGCTTCTACGACCCGAGCGAAGGCTCGATC
CTGCTGGACGGCCGAGACGTCAAGACGCTGAacgtcaagtggctgcggTCGCAGATCGGCCTCGTGTCACAAGAACCCGTGCTGTTTGCCACTTCCATCC
ACGAAAACATCGCTGCAGGCGGAGCCAACGTCACGCGTGACCAGGTCGTAGCGGCGGCAAAGTTGGCCAACGCGCACACGTTCATCCTGTCGTTGCCGGA
GCAGTACGACACGCTCGTAGGCGAGAAAGGGGTGTCGCTCTCGGGCggccagaagcagcgcgtcgccATCGCTAGAGCAATTGTTCGCGAGCCGAAGatc
ctcgtgctggacgaggcgacGAGCGCACTGGACGCGGAgagcgagcgcgtggtgcaggCTGCGCTGAACGATCTGATGGCCAAGACTCGGATGACAACGC
TGGTGATCGCCCACAGATTGAGCACCATTCGTCATGCGGACAAGATTGTGGTGGTGAATGCCGGTcacgtggtggaggagggTTCTCACGACGAGTTGGT
GGTGATTGAGGACGGAATCTATCGGAAGCTGTACACAATtcaggaggagaaggctcAGAAGGAGACTGAggcagcgtcgacggcatcggTTGAGACTGGC
ACTGCTGAAGACAAGCATCTAGGCCTGACTCGTCGACTTAGCAGTCGTTCAGCTTTTGATGACGACGCGGGTCTCAAGGATGTCGGTTCCGAGTCTCAGG
CTGAGGAGAGCACGTCCAAGTTCACTATCTTCGACGCAATGGCGTTCAGCCGCCCTGAGCGGAAGACGTTTGTCGTTGGAATCGTTGCCTCTGCGATCGT
GGGGTGCGCGTTGCCACTTTCAGCCGTTCTCATCAGTGAGCTCGTGGTGACAATGACTACCAAGTACACGGAGTACCAGATTTCCCACGCGCAATCTGCT
CTCGACGATCTCAAGCACGACGTGATGGTTTACGGACTCTGCTACATCGCTGGTGCGAGCGCGGTCTTTGTCAGCGCGTTCATCCAGAACTTCGCCTTCA
AGTAcatggccgagaagctcacgtcACGCCTCCGTGACGTCCACTTCACCGCCCTTTGCCGCCAGAACatcggcttcttcgacgacaagaagaacgccaC
GGGAGCTCTCACGGCGGAACTGTCGACGAATGCCACGAAAGTCGCTCTCATCTCGGGCGACTCGCAAGGACGCGTCGTGCAAGTTGTGTTCACGTTTGTG
GCGGCGTTGGTCGTGTCCTTTGCACTGGGGAGTTGGTTGTTGACGCTGGTGATGCTGGCCGTGTTCCCGTTCCTGATCATGggtcaagctgctcgtggca
gACACATGAAGACGGCTGGAGGTTTGTCCGATGAGCTTTCGGAGGTTGGCGCCCAAGCTTCCGAAGCTGTCAGCAACATTCGGACCGTCGCCTCGCTCGG
GTTAGAGCAATCGCTTTCTGGTAAACTGTCCGCTCTTCTTGAAGAGCCCGTGACTCGCGGTCGGCGAGAAGCCCACGCGAACGGACTCGCGCTTGGCTTT
GGGTCCTTCGTTCTCTTTGCCGCATACGCGCTGGCATTTTGGTACGGCGGCAAGCTGGTGGATGACGGCGATATCACGTTCAAGGAGTTGATGCGGACCC
TCATGGCCGTCATGATGTCAGCGCAAGGCATCGGGATAGCGACGACGTTCCTCGCCGATTCGAATCACGCTCTGAAGGCTGGCAAGGCAATTGTTGCCTT
ACGCGATCGTGTTGCCCCCATCGACTCGTTCCAAGAAGACGGTCACCGCCTTGACCAGCTTCAAGGCAAGA