Description :
From Genome Similarity Track
Location :
Scaffold_2450:1221- 2586
Transcript NameFunction/comments
Phypl_g15095hypothetical protein

Sequence
1365 bases(100 bases per row)
agcacctcctcctcggtcaGATGGTAATTCATCTCAGCATCCTTCAATACGCGGCCACAGAACCGGACTGGATGCAATCGCCCGTCGTGCTCTTACATCA
ACGTGGAACCCAGAACCCACTCATTCGCAAATAGCATGACATGCACGGCCTTGTCTCGGTCGAAATGCCGCAGTATTGGTGCGGTCACAACCCTCTGTTG
CAGCGCCGTAAAACTCCGCTTGGCTACCGTGACGTCACCCCCGGGTAGGAAATCTTCGTCTTTCAGCTGGCACAGAGCAGCTCCATACACAGCAAAGTCC
TGGATGAACCGGCTGTAATAGTTGAGTGCCCCAAGGAACGACTGCATTCCCTTCTTCGACGTCGGGAACGGCAGCTCGGACACGGCTTTTACCTTCTTGG
AATCGGCTCGTATACCCTCAGACGACACCTCGTGCGACAGGAAGTCCACCCCTGACTGGACGAAGATGCCTTTCGTGAAGCTAACACTGATCCGACACTC
TGTAAAGCGCTGAAGCAGCCGGTCGAGAGTCGTTAAACACGCATCAAACGTCTCTGAGCCAAAGCAAATATCATCCACAAACGATCGTTGATCGAACACA
GGCACCAACGAGGATTCGTCGGGCTCGCCATTAGCGAACATGTCCACAATCGGACTGTTCACCAGCAAGGCGACGGCATCCATGTTGGTCGAGGACGCTC
GGTCGGCCTCAAACTTGGTCGGACAGGCTGTCATATCGTCCCTGAGCAGCGGAGAGTCCTCGGTCACCCCTGTCCGAGCAGCATTGGCTTCCTCCTCAGC
GGCCCGCATGAGCTCCGAgaagtgtagccatccgCCTTTCGGTTGGACAAAACCCCATAGAGTGTTGTCGATCATCCGCTGATAAATCATCGGCGCATCC
TTGAGCCCGAATGGCATTCGTAGCCACTCGAAGTGCCCCAGTGCGCTCACGNGTGCGCTCACGAAGGAGTAGGCCTTCCGAGCTCTCATGGTCATCAGGA
TGGCCCAGAATCCGCTGGCTGCATCCAAGGAGCAGAACCATAGGTAGGCCTCCATATCTGTCAACAAATCATCCACAAGCGGCATAGCGTATTCCATGAT
CGCGGTCACCGCGTTCAGCATCTTGTAGTCGATGCATAGACGGATATCAACGCCGTTTTTCTTGAGGACAATCACAATCGGCGACGCCCATGGGCTGTCC
GAGAACGCGATCAGGCCAGCCTTCAGCAACCTCTTCAGAAGCTCATACAGCTTCCGAAGATGGCGGAGCGGTGTCCTCCGAGCCCTCTGTTTGATCGATG
GGTTTCGCTGTACGTCGATATCGCATACCACGCCGTACACAGGCGGCGGAAGAGCATTCCCGCTC