Description :
From Genome Similarity Track
Location :
Scaffold_13:122099- 127821
Transcript NameFunction/comments
Aphas_H257_05683Rbm13-like protein
Aphas_H257_05684Phospho-N-acetylmuramoyl-pentapeptide-transferase
Aphas_H257_05685kinesinlike protein putative

Sequence
5722 bases(100 bases per row)
CTCTATGTACGTATACTACGTAGTATGTATAATAAGAGGTAAACTGTGACAAATCACGCACATACTAAAACCTAGATACATGTAATGTCAAATGCTCGTA
AAGTGACATTTTGGTTTGATTGGACCCTACTTTATTGCTGGCGCCACCAACGAGCTCACTCTTTTGCTCCACCACCAGCAACTCGAAGCCACCAGCGCAA
GCACAGCAGCAGCAGTACCATGCAGCACGACGAAGTCATTTGGGGTGTGATCAACAACCAGTTCTGTTCGTTTAAGAGCAAGTACGTGTCCACATCCTGT
GGTTCTTCTAACCTCGTCCATGTTTGATTCTCATGTGTCGTCCAACCCAGGCTGCGCGAAGGCTCTGCGTTTTGCCGCAACGAATACAACGTCACGGGTC
TTTGCAACCGGTACGCCACGACTTGTAAAGTGCCTTGCACGTGCTTATGTTTATGTCATAGACAATCGTGTCCTTTGGCTAACAGTCGGTATGCCACCAT
CCGCGAACACAACGGCGTATGCTTCTTATACATGAAGGTACAACGCTAATCTATGCCAGTCCAATATATTAAAGTCCCTGCCATATATACATACTCACAA
CCAACTAGACCATCGAACGCGCACATTCGCCTAAAAACCTGTGGGAAAAGATCAAATTGTCCAAGAATTACACGAAATCGCTGGCCCAACTGGACGAACA
TTTGCAATATTGGCCCAAGAAGCTGCTCCATCGCAACAAACAGCGCTTGACCAAGATCCATCAGTACCTCATGCGCATGCGGAAACTTCGCATGAAGACC
AAGCCCAACTTGGTGGTCATTTCCAAGAAGATCGAGCGCCGCGAGTCGCGTCGGGAAGAAAAGGCCAAGGTCGCCGCCAAGCTCGGTACGTCGTCTAGTA
GTACTAGCAGCATCGTCGTCGTACTCATGGCCTACTACAGAAACGTCCATCGAAAAGGAATTACTCGAACGGTTGCAAAAGGGCACGTACGGCGACATTT
ACAACTTTCCTGAGCGCGAATTCACCAAGCTGTTGGACGAACACGAGGAAATCGAGAGCGAGCAAAGCGAAGACGAAGAGGTCGAAGAAGAGGTCGAATA
CGTCGAGGTAATCCTTTATTTGAGCATATATATATATATATATAAATGGATGGCCAATCGTCGCATAGGACTTTGAAGATGAGAGCGACATGGAGGACTA
CGAGCAACAAGGGTCGGATAGTGACAATGACGACGATGACGAAAGCAGCAGTGATGAAGACCAACCCAAGCGCAAAAAACCCAAACGACAGCCGACCCAA
AAGGGTCCGTACGTCGAGATCGAGTACGAACACGAACAGGAATCCGCCACGTCATAAGCTTAATAAGAATGTATGTACATCAACCTGTTGAGCATGCTGG
AGCATACTATACTATTAATACATAGCCAGGGCAGTACTAGTAGTAGTATTAACTAAAATGGTAGTCGGAGTTCATTTGGCTGGAGTGCCCGCACTGGCCA
CGCCCTGAGTCTAGTGATGAGATCGTTCCTCCCTTGCCAACTACTGGTACTCCGGACCTCGAAGAAGATGAAAGGCTCAAGGTTGGGGGTAACGAGTACA
TACTGTACTGTACGGCCAACTCAAATGCGGTCAAAGAACTCCAAGGCCAACAGCTTGATATCACCACGCGGTTGGAAATTGATGCCAGACTCAAGTGTAC
TGTACAGTTAGTTATGTGCCGAGCTCTAACCTATAGTAAACAACAGCAGTACTGCCAACACCATGAAAGTAGATCAACACAAGAACATGGTATATTTTTG
TGTTGATGGTTCTGTCGAAGGGATTCCAACTACGAAATAGATTGTAGCCAGAACCCGAAGAGCAGTGCCGAAGGAGCCAACGCGAAAGCAAGGCGAGAGA
GTTGAGTTCCCGCCATGCGCTTAGAGGCGGCGACCGCGGCGACCACCCTTTCGGCGGGTGCTGTCCGTGGGGATGGGCGTGGCATCTTCAATGCGGCCAA
TCTTGAGGCCGTTGCGGGCCAACGCGCGCAACGCAGATTGGGCACCAGGGCCAGGGGTCTTGGTGCGGTTCCCGCCCGTGGCACGGATCTTCACGTGCAA
TGCGGTGACACCCACGTCCTTGCACTTGGCAGCGACGTCTTGGGCGGCCAACTGGGCAGCGTAAGGAGAGGCTTCATCACGATCGGCCTTGACCTTCATG
CCGCCGGTGACACGCACGATGGTTTCGCGGCCCGACAAGTCGGTCACGTGCACGAACGTGTCGTTGAACGAGGCAAAGATATGCGCCACGCCGAACACTT
CCTCACCTTCACGGTTGGTAGGTCCGAGCTTGACGACTTCCGTCACGGTTTCCACAGCCTTGGCCTTCTTCGACATTCTTCAAGTGGGGGATGGAGGCCG
TCAAATGAAGGAATGGCAGGAGCACACTCGTCCGCCGAGTACAACCAATGGATATGAATCGACCAATCAAACGCGTTCGAGAGTATACAATGCAAGAGGA
CCTCAAACAATTAATAAACACATTAAAAATCCATTTATTACGTTAAATGCAAGTTATCCATAATAGTACTGGAAATTTTACTATTTAAAATAGTAAAATT
TCCAGTTATTAATAGTACTACACTTCACAGCCTTTCGTGGTATGATATGCACTTTGCACCAAAAACTACACAATGCACAATAATGCCATGAGTAATAAAA
CTAACTCCACGGCATCCTGACGAGTACGTTGCCACTTACTCTACTTCACAGTCTTACGTCGTATGCACTTTGCACCAAAAACTACACAATGCACAATAAT
GCCATGAGTAATAACTAACTCCATGGCATCCCTATTAGTACGTTGCCACGTCATTCAAGTCTCAATTTGGACCATATGTAAGTACTAGTATATATCTTTC
TCATCTATCGACGACCACGTGGGTTACTCCTTGTTCTTCTTGGCCTTCTTTTTCTTTTTGTCCACCACCACCTCTTCTTCTTCCTCGACCTTGTCTTCCT
TCTTGGCCTTCTTGGCCTTCTTCTCCGCCTTGTCGCTGCTCTTGCGCTTCTTGAGCGGCGCCGCGGCGCTCGCCTTGAGGGTCTCACTCACTTGCGCCAT
CACGTCCACGTTCTTGCGGGGCGCGGCGCCGCTTTCGTAAAACGCCAGACGTTCCTCCACTTGCTCCTTCATCTGGTCGCCGTACGCGGTCGTGGGTTCG
TCAATGAAGCTGTCGATGCGCGACGCAATGGCGCACTTGTTGGCTAGGTACCGACTGATGCGGCCCTTGTTCTTGGCCGCGGCGCGTCCGATAAAGCTAG
AATGGAACAGCAGGCCGTACTTGGGCGTGTTGCCGCGGGTCTTGAGCGCGCGGAACAGAGCCTTCTCCGCACCGAGGATCTGCACCGTGGAAGCTGGGCA
CTTGGCCAGGTTGGTCAACGAGCCGGCATGCGAGATGAGGCGGGCGCCGACGGCATCGCCGATCAGCGCTGCTAGGTTGGGCGCGACTTGGCCCATCTTG
GAGTGCAGGTACGCATGCAGCTGTTGGCGGTACTCGGCCAGCCCGATGAGGCGCGAAGTGAAGTTCGCCACGTTGAGCATGTCGAGCTCCGACATGTCCA
TACCCATGGACGTGCGCGACGCGGCGACGATGGCCGCCGCCTTGTCTTCGTCCATCGTGAGCTTGGACAGTTCCTCGATCGATTCCTCCGAGAGGGACGT
GCGGTGCTGGATGAACGCGGCGCAGCGAGCGTACACGTAGTTGTCGGGCACGATCTTGAGGAGCTCGGGGAAGTGCCACGAGTACCACTCGCGCACACGC
ATGGCGAACGTGTTGATGTCCTTGTCAAGCTGGTCGAGCAGCGCGATGGCTTGGATGATCATGTTGTCCGCGCGGTTCACGTTGAACTTTACCTTGGCGC
GCGAGTACGAGTGCCCGAGACCGAGTTGGGCCTTGGACCAGACGCCATGGTCTAGCTCCTTGATGAACTTGGCAAAGTGGAGGCGCACGCCGCGAAGTAC
TTCGAGGGTGGTTTCGTTCGTGTTGACCGACAAGTGGAGCGCGTCCGTGATGGATTGCGCGAGACCTTTGTCCGACACGCCGAGGGTGACCGCGGCGGAC
TTGGACTTCTTCGCCTTGGGGAGGTTCAACTCGAGGAACGCTTGCAAGTCGTCCGTGACCAACCCTTCCGAGATCGCGTTGATGTTTTCGAGCGCGGATT
CAGCCGACACGAAGGGAGAGAACGCCTTGAGCTTGACGGCGGCACCGAACTTGCCCAAGTCTTGCACGCCCTGTTGCACTTGATCGAGCAACACGGCAAT
CTGCTCCGACTCGACCACTTCGAAGAGCGCGTACCCGGAGGCCGATTCGAACAACACAAACGAGGCCTACATGGAGAACAGCAATGAGCCTGCATGCCCG
TGGTAGATGCAGCGAGCATGATGCTGCACGACGAAGAGCTGCATCCACAGAGACGTCGACGTGACGTACCATTTTGCTGTGGAAATCGGAAAATGGTTGG
TCAGTGGATCGAAACTCTTGCGGATGGACCCCACACCACCAATCAAAACGACAGGGCGAAGCACCAAATTGCAATTCCCTCGGTTTACAAACACCTATCC
CCATTATGCCGTATTCGTCATAGGAAAGTCGAATATTCCCTATGTTTACTGACACATGGCGTGGATTGGTCAAAATACTGACCCCCAGTTCAAAATATTT
GTATACAGATTTTCCCTAAATCAGCCATAATTTCATTAACGTTATCCATCCCAATATATATTAACTCCGCCACATCAGAATAGTCCTTACACGAGTGCCT
CCTATCCCTTGATCTCTGTGCGAAGTTACCAGTATCATTGCTTATGATCTGTGTGAGAAGCTGTCATTGCTTGCTTTTACACTATAGGCTCTATTCTTGG
CGGAAACCGTAGAAGTCACGCCACCGAGTCGCCTTCGCTAGCGGCAACATCGTCGTCCACAACACTTCCAGCTTTGAGCTGCTTGATGATGGCTTTGAGC
TTGGCCACTTCTTCGCTGTCGGACGTCTTGTTGGCCTGGTTTGTGATCAACTTGACGCGGGATGCATAAGACAAGCTCGTTTGCGTTTCTTCCTGGTACC
AATATCAGTATTCAAAGATGTCGTCGATATTTCAGGACATAGGATATAGTACTTGGTTGTAGTCGGCGGGCGAAATGTTGACAAACATCAGCTAATAGGG
GTTGGTAATATTAGCGACACGAAAAATATTTAATATATTATAAACTGTCGCACCGTTTTGGCATTGCCGCCCAGCGAGTCTTGCATGAGTTGCGTCAACT
ACTCGAGTTTTCATTGTCATGTTCAGTCAAATGAATAGGCAACGTTCAATATATTAATATGGAAACCCATGATTTATACCCTATGTAATATTATTCAACA
TATGAATAGGCGTAAAACTGTGATTTATATCCTAATAATTAATATTTGTGTCGTGTCGTACCTTGTTGTTCCGGTATGGAATGAACTTTTCATTTGTGGA
GAGGGCGGAAATGACATCGCCCAGTGCTACATAGTTGAGCCAAGGTCAGACAATAACACATGAAATATTCATGACCATATATATATATATATATTTAATA
CCCACCACTCAAGCTTTTGTTGATAGCTTGCGCTTCTTTCAACCGGTCTGCGGTGGCGCCGGTCTTGCCTGCCCGTTCGGAACCAGCCAAATCCACCAGA
CTCAGCTTGCCCACACTTGTCT