Description :
From Genome Similarity Track
Location :
Scaffold_133:12209- 15146
Sequence
2937 bases(100 bases per row)
GAGCACATAGGTCTCGCATCCCTGACCCGTCCGATCAGCTCGCGGTCGACTTTCGAAGAAGTCGTCAATCGATTTGACCTGCTCTGGCGGCAGGGGCCAC
TGCCGCGTGACACAGTACTTCGTGCCCGGCACGAGATCAAACTCGTGCTGGATGCCCTTGTTCTGCGGAGGCTCCGCAGGGATCTCCTTCGGAAGTACGT
CCGCGTACTCCCGTAATATCTTGTAGTAGGGACTCGTCTTCAACGAGTCCCAGCTCTGTTCTTCAAAGCGCTCCTTCTTCGTCTTCGCACTGAGAGTGTC
CTCACTCAGTGGTGCTCTCCATGAAGAACTGAGGCAGTTCTTCATTCTCCCTCTTCGTTCTCTCGGCGTCCGAGAGAATGCATATTTGCTCGGTGCGTCC
ATCGTGTAAGTCAAGCGCGAAGCGCTTCCAGCTCACGGCTGGAAGCAAAGTCAACTACGACGCTTGTGTCGGAGGATTAGCGAGAGGCATCTCCCTGTAT
CGGAACCCAGCACAGGTACGCGTCAAGACGTTCAACGTCTCGACGTCCGGCTTCTCTGTCTCCGTCTGCCCGGCTGACTTCTCTGTCTCCGTCTGTCCGG
CTGACGTCTCGGCCCCAGGCCGAGACTTGCGCAGCGACCTTCGCATGCGCCGTCTTCTTGTTTTGCGTAGCCCGGCTCCGCTTGGCTCTTGACCTCGCCT
AGGCCCAGCCGTGGGCGGGTGTTCTTCTTTTATTCCGCCGGCGGGTATATCCCGCGGGCGAGCGACTTCAAGCCCGGCTTTGTCGCTCGGCATTTCGGAA
ATCGACACATTTTCTCCTTCAGCCGTCGGCGGCGACGCCGACGCTTGCTGCTCTTGCGCGCGTGCTCGCGCGCGACCAGGGCATTCCGGGACAGCGCCAT
TAGGCACTGTCTTGACGGGAGAGTCGCGCGCACCTATCGGTGCGTGCATTGCGACAACAGGACCATCGCTCTCTGTTCCGCTATCGCGACCGAAGCGCAC
AAGAGTGCGCATCTCCCAGCCTATTACCCGATCATGCCGTGCAAGCCAGGGCATGCCGTGGCTCAACACAATGTCAAACTTCTCGTCCAGGTCCAGGACG
ATGAAGTGTTCGACAAACACTCGATGTTCGTGCATGATGCGCACCATGCGCTTCTCGGTTTTAACGATGGCACCCGTTGCCAATCGAATTTCCAACATAC
TTCGAGGTATGATTACCTCCTCGAAGTCAAGCCTTGATATACTTCGCAGTCGAACAAAGTTGTTCGACGCGCCTAAATCAACCAAAGCACGAAGAGAGTG
AGTTGCTCTCTCTCTTCGAAGACACGTCCAAGATGACAAGGTTCGGTTTGTCATCATGCATTTTGCAGTGAGAATTGTCCTCACTGGGGGGCTGCAGTCC
TCAGTGTCGCATGTCCGAGTTGGACACGCGTGACTGCTTCACCGGTAATCCACCCCACGCCTACAGGGTTCCAGCGTTTTTTGTTTGTCGGCGACGATGC
CCGGCATCGCCGCATCGACCACCATCTCGGTGCACGGGTGCCGTGCACTCTCGGGCATAGTGACCGATTCTTCCGCAACGGAAACATCGTACATTGCTCC
CTTGTTGCTGTTGATAACCAGCAGCCGTTGCATTCGAGAGGTCCATTGGTTTCGGCCCTCCCGCTATCGCGACCGGAGGCGGTTGCAGCCTCGGCGCATT
CGCATGCAGTTTAACCTGCCTCAGACTAAACTCCCCCTGCATCGCAAGAGTAATCGCAGCTTCGAGAGTACCTGGGTACTCACGGAAGAGATAGGTCTTC
ACAGGCCCATCTCTCAGACCCTTCATCAACGTGACGACCTTGGTCGCCTCGTCTATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGCG
CGTAAGCATGGACATCATACTTACCCTGCTGCAGGTCGAGGAACTCCGCCCTCGACCGGAATTCATTTTGCGGAGGCTCAAACGCTCGCCTTAGCGCCTC
CTTGAAACCCGCGTACGTGCTGAAGCACGTAGGATCCGAGAGTCGGCGTCCATACGCCTAACTTCTCGCTCGTCCGCCAAGACATGACATGGCAAACGCA
ACCTTGGACAACGGGTCGACAATACGTCGAGTCGCAATGGCAGTGTCGTGTTCGACAAGCCAACGGAAGAGAGGCTCGTCCTCTCTTCCGACATAGTTGC
TCACGTTTAGCTTCAACGATTGCTCACGCGGTGTCGTCCCCAACGGCACCATGGTAGAGGAAGAAGCATCACGCTGCTCCTTCATGATGAACCCCAGAGC
AACACCATGTTGCTTTGTCGGCGATAACGTACGTAGCATCGCAGCTACTGCCGCCTCCCCAATGACTGTTGACAGTCTTAGAGTGCCTCCCACTCTGGAT
CCGACAGGTGGAGGCAATTATCGCGTACAACATGAGTTGCAGGCGTAGTGGAGCTTTCAATGGGCTCCTCCGTGCTCATGAAAAGTTTATCGGCTCCTCG
TTCGTACAGCTCCGTACGAACGTTCAGGTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGCCTACTTTGGCTCACTACTACGACTC
ACACGTATGCGCACGTGTATGAGGAAGCGTAGGTTTCTTTTAATTGACTTAAGTATACTCGAGATCCACGAGTATACTTTAAACAAGATAATGACTCTAA
GTAGCCGCTTTTGGTAAAGATGAGAACTGTTATTGTGATTTATGCTTTGACTTCCCCTAAATGAAATATTTTAAACTAGGAATCTGCCAACGGCTGGTTG
GCAGGATTCTTCTAACATTCAAGTCGCTCATTGGCTAAAAGATGCTGCTTTCATCCAATAGGAATCCTAAATATGTATGAACCACCCGTCGTGGTGGTCC
CAAATGTCTGAACCATTGGTGTACCTTACACCAAGGT