Description :
From Genome Similarity Track
Location :
Scaffold_33:122085- 129287
Transcript NameFunction/comments
Phypa_INRA-310PPTG_13473hypothetical protein
Phypa_INRA-310PPTG_13474hypothetical protein
Phypa_INRA-310PPTG_13475hypothetical protein
Phypa_INRA-310PPTG_13476hypothetical protein

Sequence
7202 bases(100 bases per row)
CGGCTGCACGTGGTCATACGCACTGCACAATTATCGCAGCTCCAGCACGTATTACCCGTGACAACGTGCGGAAGATGCATGCCAAGACCAAGCTCTCTTT
CCCTGGAATTATTAACCATGTTTCTGGAAGCCCTCACGCAGAGGCCGAGTTGGCCGTGGTTACGAGCGATGGCACGGTTCGGCGCTGGGATCCAGAAGGA
GGAGTCCAAACTGTCAAGAAAGACTCGTATGCATCGGATCGCATTTTACGCTGTGAATACTCCAGGTGTGTAAATACGAAATGTGGTTTGATGTTCTGAT
AGCATCACTAATCGCATTGTTTTCAGCCATCCATGCGTGCTCTGGACAGCAAATCGAGCCACACTGAATGCCCTTGATCTCCGACAGCCAGCGCAACACT
CAAGGAAGCTGTTTGATCTGGCGGGCGCAGGCACTTTCGTGACGATTTATGACGTGAAGCGTAGAGCAAGGTACGGACTAAATTGTGATCCTACGAATAC
GTTAACCTCGGACTGATTGCGCTTGTGTATTCAAATATTTCAGCAATCCGTTCCAGTTTGCTGTTGGCACGGGTGTTTCCATTGAACTTTTGGACAGTCG
TATGGCAAGACAACCTCTCATATCGTGGGTTCAACCGCAAAGCTTTTCTGGCGAGCAGGAGTTTTCGTTTGGAGCGATTGGCGAAGTGAATTTGTCAAGA
AACACCAACGATTCACGAGGTAGGCAAGCAATTTGGTCATGAACCGAAGCAAAACTCACACACTAACCTCTTATTTTGGCTACTTGCGAAGGATACATCG
TATCGAGTTCAATGAGAACGAAAGTAACAACGCTTTTCCCATTCGAGCGAAGCCAGAAGAGGAAACGCGGTAAGGTCATGTCGTTGACCCCATTACGCTC
CAACGGGGACGACGACGAATATTCAGATATTCCACGATCTAGCACCGAGCAGATTGTTGCTTCTGACGCACCATTGGATTTGCGCATGGAAGATGGCGGA
GAATATACCCATTTAACGGGCATTTGCGCGTTGCGGGAGGGAAACCCTGGATCTGCGAGCATTTACCAGCTCAACAGCCTGGGAGATCTGTTTTCTCATC
GAGTATCATCCGGTCGTTCTCAGACGAAGTCTTATGGCACTGCCGTTCAGCCCGAGTACGTCCACAGTCTCTTCGTTATTTTTTCTTGTACCTAACATCT
CTGTTTTGAATGGACAGCTTGCCGAGTGGAGTGACAGCACAGGATGAACCTACAGATAAACCAACGGCTAGAACACTCCCGATACCGGTGGATGCTATTC
TTCCTGAGCACGATACAGAGTCGATGCAACTGTTTATGACACTTCCTGTCAAAGTTCTTCGCCGACAATTCCCACGTCTACCAAAACACGAGGAGCCATC
TACAATGGAAGAGATAAACAGAGAGGACGAGACACATATAGCACTCTCCAGCCAAGACATGAGCAAGGACGTCAAGACACTCTATGCAACCCCAAAGATC
ATCCGCAGATTCCGCTCACGAAATGTCGATAAGAAGGAGGGAAGCAAAGAATCATTGGCTAGCCATTCAAGGCTTTCACGAAGCATCGACAAAGATGAGC
TTGTCGAAAAACTTCGTAGCGTGTGTATCCCATCCGCTTCACTATTCCGACTGCACCGGTATGTGGTCGAAAAACTGAAGATCGAGATCTCGTCTTCCAA
ATTGCTGCTGCTTCTTCGCTCATGCAACGAGTTTCGGATCCGAATGGTGCGCCACTCGCTTCCAACAGACACGCTTCGTGTGCTGAACCCGTCATTGCCA
GGAGCTGACAACGTGCACTGCGGAAAGGACGATCCTCGTGTAGCTACCTGCACGTGTCGTCCAGGTGCGGCGAATTCACAGCTACCGTGCCAGTCCTGGT
CCTGCGTTATCCCTCACGCAGTTATCGTGTCCAGCACTTTACCCGAAATACTGTTGGACGACACAGCTCCCACGTCGGCTGTGACGCAAGACATGCCGCA
AGATCTTGCCGATATCATTACTGCAGCACATGCAGTGTACGATGACATGTACGAATCCGAATGAATGTAATTTCTCGGTTGAGGTATCCAGAGTGATGGT
CGTTTTGCCGTTCCAGATTTGTAAATAACGTTTTTTCTCCTTGAGTGTCACTGTTTTGAAACCAAAATGAACAAGAAGGTCGTGCTGGAGGAGGAGGAGT
ATGTGGAGGCGCTAGGCCAGATTATCGAGCGCGACTTCTTCCCAGACCTACCCAAGCTCAAGAAGCAGACAAAGGTGCGCTTCTAACAACCTCTTGCGTT
TCAACTGCAGTCTGTTGTGTCACAAAAGCCAACAAAACTGGGTTCTTTGGCTGCTGTTACTTTACCATTTCAGCTGCTACGAGGCGAAGAAGAAGGTTTA
CCGTGGACTGACACAACACTGCGTGTTGCGTCTACTTCTCGAGGCAACGTATCAGTATGGAGCAACATAAGTGACTCAGGATGGGACCAACCTACTCCCG
TAGTGGAGCATTCAGCTGATGATCAAGTACAGGGTGAAGATTCAGACGATAGTGCGAAGACTTCCATGACGCTGAATCGCTTTGTTGCGACCCATACTTC
CGAGGACAATGAATCATTCAATGAGCTGCAAGAAAAAGCGGTAAAAGACCATCAACGACGATACCATTGGGCGTTCGTCGATGACAAGGAAAAAGGCGAC
CCCAAGCTCCACTTGTTGACGAACGGGACTTGGATTTCAAAAGAGCAGCGGCAGATTGCAGACGAAGCCTGTGCTTCGAAAGGTTAATCACTGATATAGC
TTCACGATTGTGAATTCTTGCTTATCACTGTAGCTGCTGCTCATTGACACTTTCAGGTCCGAAAGACTATAGGCCAAGTGCTCCGGAGACGTGGAAATAT
CGCGCAAGAAACCCACTTCTCTTCCCTCCTGAGCTAGAAGCAACGCGAGATATCTGCCAAGTAGGTGTTGTTGATAATTATCGAGAGACGAAGTTTCTAA
CAGACGCAATGCTTCCATGCAACAGGTTAAAGCGGATCCAGGAGACCAGTTGTTACTCGAAAACAGTTCAAAGTCGCAGTCAAAACTACCGCCAAGGCCC
GGAAAGAAGACTGTCTACGCTAACTCCAGGTTTTCTTCAGATGATATTAAAGTAAGTCGTTCAGCTGCCAGTTTCTTGTAGTAGAACTATTCCATCTAAC
AGCATTCTGTGCGTTTTGTTGTGGCTACACTATAATAGCTTGATGGATCCGAATCAGGAGGAAATCAAGCGTCTTCACGAAAGGATTACTCCTTAGTGCC
GATGACACCACTCATTGCTCCTGGTGTGGATGCAAGCCCACTGATGACCTGGGGAGACATTGAAGGCACACCAACGAATCTAGGCTCACAAGCAACATCA
GGTACGTGCATCGGTTGTCTATAATGAATACCAAGGCGAACTTATCTCTGCTGCCTCTACTTTTGTAGCACGCCTTCAGAACACGCCTAGTTTCGAACTT
AAAGATACGTCTCAACGAGAAAAGCTGGCAAGTCGACTTGAATCTGAAGCTGTAAGTCTACGCTTTTCATCCGATAAAGCTATTAGGTGCATGAGTTGAA
CGTTACTGTGGTTCCGATTAATTGGTGTTTAGCGCCACCGCAATCCCACCTCGCGGTTGCCGGGGATCAAAACGCCTTCTAAGAAGCGTCGGAAGACTGA
ACAAACGCCCGTATCACGCAGTGTTCGCGCCCGCATATCAAGTGGTCGGTCAGTTCTACGCACCCCACTGGGCTCAGATCCGCAGTTACGAGCAAGCTAT
TCTACACCTCTATGGCCACCACGTTTTTCGTCCAAGACGCGGAAGACGAGATGAGTCCAGAAAAGCAACGTCGCGATATGTATGGCAGAGCATAAGGTTT
GTCAGAGCCTGATACGTTTTTAGATTTCTATGAATATGCCATTGACGCTGAACTTGCTCGACCTTGCTGCTCAAGATGATACAACAGTTGTTTGTACTCC
ATCACAGGAAGGGAGCAAGTTGTTGACACATTGAAACCAATTCGATCTCGATGGCTATCAATGAAGAGGTTTACAAGGCTGTAGTTGTGGGTGGAGGTCC
AGCAGGGATCGGCGTGTTTGTACGAGCGGCGCGTGGAGGCCTACTACCTCGATTGCTGAATCCGGACAAGCATGGAACGACGAAGGATACCGAGCTTAGC
ACTCAACTTGGATTCAAGCAAATGGGCGTCGTAGTCCTTCATTCAGGCGGTGCCGAAACATTTGGAGGTGGCAATTTAGGCGAATACATCATCAACTCAA
ACACGTTCGCATGCGGTCTACTGGCCAGCGTCCTCGACGAGAAACCCGATCTAGATCCACCGGAGAGTATTAAAAATACGTTCCTGGAGAAAGTGCGCGT
TCACGAAAGTGCCAAGCGCTTGGAAGAAATTGGTGCTGCGCCCGGGAATCTCACGGAAATTGGCCGCTTTTTGCGTCGTGTTGGAGCGTGTCTGATCGAA
GAAATCTCTGACAAAGCTTCTGATACCAGCAAAGTTCTGTTGCATACGGCAGCAGTCAAGTACGAAGCTCTGGAGAATGGCCTTATTCGTGTGAAGGCTC
AAAGGACTAATGGCAGTGGTGATACCGTAATACTTCACACAGAGCACCTTATATTGGCAATGGGAGGCACACAAGAGCTGCCTTCCCTAGACAACCCTGC
CTATCACTCCAAGCTATTTGCCTCCGATTCCTGTCTGCGGGAGGACGGGTTTGCAAAACTCAAAGAGCACCTCCTCGCACTGCCTACAGGCGAGCGGAAA
GTCTGCATTGTCGGTGGGTCTCACAGCTCATTTTCGGTGGCGTGGCTCTTGTTAAACAAATTTATGGATCCAAAAGCAACTGCTACGAGGAAAGTCTCAC
AAATTCCAGGAAGCCCAAAGACGCAATCTCTATCGGACCCGCAAAAGAACAATAAGGATAGCGAGACTCCTTTCGCCACACCGCAACTTGCCAGCATTGG
AGCACCTGTGACAGCCGCGGCGCCTGTTTCCCCCCTCACCATTAAGAAATGTGAGACTGCTACTTCCACTATTGCAAAGGTAAAGCGCACATCACTAGCG
GGAGCAAACGATACGTCATCGCCGAAGTCGATTTTTAATCCCAAGGACATCATGATCCTGCATCGATCTCCAGTTCGATGTTATTATGGCTCCAAGAAGG
AAGCTGAGGTGGACGGTGTCGATGCGAGTCGAGTTGATCGATCCGGTTGTGTGAATACCTTCACGGGGCTGCGGGAAGACGCCAAAAGGCTTTTCAAGAG
CGTGAAATCAGGGCGCGAGGTGCGTGTCAGGCTATTCCAAGTGAATCAGCAGGGCTCTCAAGCACTCACTGACAAAGCATACGCCACAGCAGGAGCAATT
GTCTGGGGTGCCGGCTACAAGACCAATATGCTTCCTGGTTCGGATGAAGCGGGCAATCCGCTCGTTTTCCACCAAGACAACGGTGTCGTCAAGCTCGATA
ATAAGGCTCGATTGCAGTTGCTTGGCCCTTTTAAAGGCAAGCGGCCTAGTATTTTAGGTCTCGGCCTGGGGTTCAGTTTGCGTTCAGCAGTTGATGAAAT
GGGGACGGAGACGCGTGTTGACGGTGTATCGATATATCATCGCCGTGGTGCTGCGTTGGTGTTAGAAGCGCTCTTCGGACCGGAGGTGTATGGCACCAGC
TCGAGCTTCGAAGAGATGGTGGAAAAGGCGAGCTTGACGCATCAGAAGCATTTGACATTGGCGACCTGGTATTTTTCTGACTCTTGTCTGAACTGCATAC
AGAACGATAAAAAGAAGCGAGAGGTCCAGGCGATGAAGGCTGAAAAGTACGTTCTGCTCCTTCCTGACTGCCAAGTACGAGTTCGGACTGATCAACCCGC
AGGGGTATTGCATCTTCCTTCTTTTCGTTTCTGCGAGTATAGGGCGCGAAATGCGAGTGATGCCGACGGCGAGCAGACCTTGCTGTCGCCTTCAAGAAGC
CGCATCTCTCGTAGTGGCAGCGTGACCGCACCGCTTTCCCCAGTACGTCCATACAGCGGTGAGCAATGCATTGAACGGAATCTGACTAGTGTTTTGTTTT
TGCTAGATGGCGCCCACTGCGCGCGTAATAGTCCGACAGAGCCCTTCAAAGAAATTGCAACAAAAGAAGTCGGACTCAGCGCCAACAAACCCGCCCGTGA
AATTGCTGCTGCTTCGGCGCCGCGCCTCCGCAGACTCGTCAACTATGGAACTCTCTACCGTCGCATTGGAGCCCGCAGCTGTGGAACCGGAGAGCTCCGC
ATTGCCACAGACCTCAGCGTAGCTTAGATGACGGACTTCACCGTTTCACAAAACAACATCGCAAAAAAGTGTCTAGTGCAGTTTTCCGCAAAATTTCATC
CTTACAGGTTGAAGATTGAATACATTTTCCAAGACTATTTGGATACGGACAGTTGAAACGTCACGTCCAAAAACAGAAAGTGAGAGATGTATCTATGGAA
CGTCTCACTCGTGGAGAAAACTCAGGTCAAGTGTGCGGCAACTTACTTGCCTACAGTCAAGTGTACTGAGCTCAGATTAGACTCTCTCCGGTAGCGCGGC
ATTTGCTCTTCCGCCGTCCATCAGCCGCAAGAGACTCGACCATGGAGATCGCGATGCGCCGTCGAACTTTCTGCGGCAAGACTCACCTGCGCCGCCTTAA
GGCGGAGCGCTCGAGTCTCTCCAAGCTCGACGACGAACAGCCCAAGCCGTCGCTTCCCAGTCCGCGCCCCATCCGACTTCTGCACGAGAGCGCCATGGCC
GAGCTCTACCAGGAGCAGCAGCGCCCATCATCTCACTCTCGTTCGAGCCGTCGCCCAGCATCCTCTTCCGCTTCGTCCTTCTCGTCTTCAGAATCATCGA
CGGCCTCACTACGCCGACTCCTGGAAGAATCAGAAGAGCAACTTGCTCGAGCCCTTGCTCAAGCAGAAGGAGGCACAGCCGACGCCGCTCAGTTAGACGA
ACTCAACGCTCGAGTGGCAGCCTTCTCCGCCGCGTCCTCCTTACTTCGAGCAAGTATCTCCAGCAGTGCGTTACTCGGAGGAGGCCCCGACTCCGACGAA
CAGCCGCGAGCGGACGCCCCGATAATGAGTTTGTCCGCTCCTGCCACTATTACTGGCGGCAACATCGCAGTCTTGGATTCAAGCGACAGCATTGACATAA
CA