Description :
From Genome Similarity Track
Location :
contig_18:122085- 125115
Transcript NameFunction/comments
g4588.t1hypothetical protein

Sequence
3030 bases(100 bases per row)
AGATTACCGCTACGTGCACCTTAATGCGGACAACGCCGGCTACTGCAGCAACTTGGTCATCACGAGCCGCTTCACCGTGTACAACTTCCTGCCCAAGCTG
CTCTTCTACGAGTTCAGCAAGCTGGCCAACGCCTACTTCCTCGTCATCTCCGTCATGCAGACCATCAAGCCCATCTCCAACACGGGCGGCTTCCCCGCGT
CGCTGCCGGCGCTGTCCATTATCGTGCTCATCGACATGTTCTTCGCCTGTCTGGAGGACTACAAGCGCCACAAGGCGGACCATATCGCCAACAACTTGCC
ATGTCTACGCTTCCAGAAGGAGAGCAGGGCGTTCGAGTCCGCCAAGTGGCACATGCTGCAGGTCGGGGACGTGGTGAAAGTGGCGAACCGAGACCCGGTC
CCGGCGGACCTGGTGATTCTAGGAGCCTGTGAGCCCGAGCCGACGAACCCCGCGGGCATTTGCTACGTGGAGACGAAATCGTTGGACGGAGAGACCAATT
TGAAGCTGAGACAGGGACTGGAGGCCACGTACACGGCGCTGCTGAGTGACGCCGCGGTCGGAGACTTGAAGGGGACCGTCGTGTGCGAGACGCCCAACAA
CGCGATCCACCGCTTCAGCGGCTCCATGACGCTCGAGGGGGGCAAGAAGGAGGTCATCACGACAAACGCCATCGTGCTGCGCGGCTCGACGCTGCGCAAC
ACGGAGTACATCTATGGTCTCGTGGTGAACACGGGCCCGGACACGAAGATCATGATGGCCTCGTCGTCCGAGCCCATGAAGTGGAGCAACATGGAGAAGC
GCCTGAACAAGCAGATTCTGTACATTTGTATGCTCATGGTGGCGCTGTGCCTCACGGGCGCAATTTTGTCGACGGTCTGGAACGCTCAAAATCTGGACAA
GGACGCGCACAAGGCCGCGTGGTATTTGTATGATGGCAACTCGACGGCCGTCAAGTCGCCCACGGGGAAGCTTTTTCATCATGGTGCTCTACTACTTTTG
CTGCTGAACTCGTTCATCCCCGTGTCGCTGTACGTGAGTATGACGTCCGTGAAGTTCATGCAGTCGTATTTCATGAACAACGACCTGGAAATGTACCACG
ACGAGACGGACACGCCGTGCCAAGTGCGCACGATGTCTCTGAACGAGGAGCTCGGTCAGATCGACTACATTTTCTCAGACAAGACGGGCACCCTGACGTG
CAACATTATGGAGTTCCGCAAGTGCTCCATCAATGGCGTCGCGTATGGCATGGGCGAGACGGAGGTGGGTATTGCAGCCAGGAAGCGACAGCAGGAAGAA
GCACCGATGACGTCCTCGTTTTTTGCAGTAACTCCCGGTGGCGGCTGTGCGGTTCCGATGAGGAAAGACCGCATTGATACTGCGCCGGACTCGAACAATC
CTCCGACGGATCGTGTGGTCAAGGCTCCCTTCGTTAACTACCAGGACGATGCACTGTTCGAAGCGCTGGCGCAGAAGAACAGTGTCCAGGCGAAGTCAAT
CGGATCATTTTTTGAGCATTTGGCAGTGTGCCACACAGTCATGCCGGAAAAGGCCCCGGACAACAGTCTGCGCTTGAGTGCGTCTTCTCCGGATGAGCAA
GCGCTGGTCGCTGCGGCTGCGTGCTTTGGCTACAAGTTTGTGGCTCGTGGACCTGGTAAGGCGATGGTCGAGTACTTTTCTTGCGTCGATCGCCCAGAAG
AGATGACGTGCAATCAGCCGGTTGCTGATCACCCCGTTGGCGGCTACGAGATCCTGGAGGTACTCGAGTTTAACAGCACACGCAAGCGTATGTCGGTCAT
CCTCAAGGCCCCCCACGGCGAGTTGAAACTGTTCTGCAAGGGAGCGGACACCGTCATGTACGAGCGCTTGAGACCGACGAACGACCCTGCTGTCAAGCAG
ACGCGCAACCTGACGTTGCAGCACATGGAGCAATTTGCGTCGGAGGGTCTGCGAACGCTCGTGATTGGCATGACGGACATTGATCCGGCGTTCTTTGAGT
CGTGGGTGATCCGCTACCGCACAGCCATCAACGATATGCGTCAGATCGACCTGCGTCGCAATGGCGAGGACAATGACATTGATCGGCTGATGGAGGAAAT
TGAGGTGAATCTGGACATTTTAGGTGCGACTGCAATTGAGGACCGGCTGCAGGCAGAAGTCCCTGATACAATTTACAAACTGCGTCAGGCATCCATTAAG
ATCTGGATGCTTACTGGTGACAAGGAGGAGACAGCGATCAACATCGGCTTTGCTTGCCGTCTGCTCGCCTCGGACATCGAGCGGATTGTGATCTCGGCGG
ATACGCACCCGGACTTGGCTAGCATCATGGACGAGCTGGAAGCATACAACCGTGAGGATGACAATGAAGACACTTCGGCGTCGACAGCAGCTGGAGCGCT
TGGTGTATCGGTTTCGTCAGAGGCTCGACACTCGGTCTCGCTTCGGAACCAGCGCAAGCGAATGACCCGCATCGAGAGCATGGCGGAGATGCCAAAACAA
GATTTGGGGCTGGTGATTGATGGCGAAACACTGGAGCTTGCGCTGGAAGAGTGCCCTGAGCTACTACTGAAGGTGGCGGAGAAGTGCGTGGCAGTGATTG
CTTGTCGTGTGTCTCCTGCCCAGAAGGCTCAATTGGTGCGACTGGTTCGTGACAACAACCCTGAAATCCGAACTCTGGCCATCGGTGATGGTGCCAACGA
TGTCTCCATGATTCAAGCCGCACACGTGGGTGTTGGTATATCTGGACAGGAAGGTATGCAGGCTGCGAACTCATCGGACTATGCCATCGCGCAGTTCCGC
TTCCTGTCCCGACTGTTACTCGTCCACGGACGATGGAACTACGTGCGCATGGGCAAGTTGATCCTGTACATTTTCTACAAGAATGTGATTCTGAACCTGA
CGCAGTTCTGGTACATGATCTACACGGGCTACTCGGGACAGAAGTTCTTCCTCGAATGGGGGCTTCAGGGCTACAATCTGCTCTTCACAGCACTACCTAT
CGTACTCGTGAGCACCTTCGAACAGGATGT