Description :
From Genome Similarity Track
Location :
contig_82:122064- 123936
Transcript NameFunction/comments
g12095.t1hypothetical protein

Sequence
1872 bases(100 bases per row)
ACCGACCGAGAGTCTCGCCAGTGCACGTACTGCGGGAAATTGGGGCACACGATCAACAAGTGCTGGACCAAGCAGAAGGACGAGAATCGGGGCCCAAGAC
GCGGCGGCAATGGCAATGGCCGTGGACGCGGGGCCAACAATGCCCAGTGGAGGAACGACGACGCCAACTACGACTACGGCTACGGCTATGATCGAGTGGC
GTTCGCGGTCTCACTGGAGTGTGGCATTTCGACGGGCAAGGATATGCTCGGCATGTGGGCGGTCGACAGCGGCGCAACGCACCACATCTGCAACGACAAG
GCCAAGTTCGCCCATTTGATTGAGCGAAACGAGGGCGAACTTTCGGTGGCCGACGGCAACAAGGCGGCCATCATGGGTGTGGGAACCATCGTGGAACGAG
TGGTTCTGCCCAACGGCGACGAGCGCGACATCGAGATCAAGAACGCGCTGTACGTGCCGAGCATGAGCAAGAATCTGCTCTCCGTGCCACAGATCAACAA
GAGTGGTCTGTTCCAAGTCGTGTTCGACGGCGCCCAGATGCGCGTTGCGCACAAGGCCTCCAAGCAAGTGGTGGCGGCGGCGAACCTCGTGGATGGCCTC
TACTGGATCCAGACGCCTCAGCGATCGGCGAATGCAGCGACCAGTGGGAAGACGGTCGACCTGCACGCGCGTATGGGTCACGCTCCGGTGGAGGTGCTTC
GCAAGATGATCGACAACGACATGATCAAGGACGCGAAGGCACCTTCCAAGTCGAGTGGACCAAGCGTGTGTCGCGGCTGTCAGCAAGGGAAAATGGTCCA
GAAGCCGTTCCCAAGCAACCGTGACAAGCGCCTACGACACGTTCGAGCTGCTCCACTTCGACATCTGCGGCCCCATGGAAGAAGAGTCTCTGGTGGCAGC
AAGTATCTGCTGCTGATCGTGGACGAAGCCAGCGGATGCATGAAGGGGTTCTGCCTGCGTGCCAAGTCGGAGAGCGAAGACTGCATCAAGACGTACGTCA
CGAAGGTGCAGACGCAGTTCGGCAAGAAGGTCAAGTTTGTGCGGCACGACGGAGCTCGTGAGTTCGCGACCAACTCGCTCAAGGCCTTCTACGAAGTCGA
AGGCATCGAGCAGCAAACCACGGTTCCGTACGCGCACCAGACCAACGGCACGGCAGAACGCGCCATCCGGACCATCGTCACGATCGGCCGCAGCATGCTG
CATCACGCCAAGTTGGACAAGTGTTTCTGGGCTGAGGCGGCCATGACGGCCATCTACGTGAAGAACCGCCTGCCGTCACCCAAGGGAGCACAAGACTCCA
TTCGAGATCGTGTACAAGTCCAACCAAGTGTCAAGCACATGCGTGTGTTCCGGATGCCAGACGTACATCCTGACGCCGAAGGAAAAGCGGCGCAAGTGGG
ACCCCAAGGCTCGCGCCGGTTGTTCCTCGGCTACGAAGAAGTGTCCAAGGCGTATCGACTTTATGACATCGAGGCGGGGCAGGTGGTTGTCAGTCGCGAT
GTCAACTTCGATGAGTCGGCCTTTGGACTTTCGGCGCATACTTCGGATGAAGACGTCGATGATGCTGCGCTGGACCTGGACGCGCTGGACCTGGACGACA
ACGATGGACCGCGCCAAACGAGCTTCAAGCAGGCGGGGAAGCGCAAGAGCCGACCGAGTGGCGACGACGACACTGCCAGAAGATCGCGCCCCGTTCGCCA
CCGAGCTGGCTTAGAAGAAGCAAGTGCGCCGGACGTATCCTCGTCGCGCCGAGCTGAACCCGACGAAGAAGAAAAGTCTGGGGACCAAGATGAAGACGAC
GACTCGACGCCTCCAGTGTTTTGGCGTGCCAGTGCCAACGCTGTGGAAGCAGCAGCCGATCTATCGGAGCCG