Description :
From Genome Similarity Track
Location :
Scaffold_310:12204- 14820
Transcript NameFunction/comments
Phyci_99301Hypothetical protein
Phyci_454451Hypothetical protein
Phyci_99302carbohydrate-binding protein, putative

Sequence
2616 bases(100 bases per row)
CACTCTCCGTCATCGCCGTAGGCGTAGCAGTTGTACTCGGTCCAGGCCCCGATCGTCGTCCAGATCGAGTCGCTTTCCCTCTCACTCAGACAGCGGTTGC
ACTTCTTCTCCGAGCGATTGCAGACCTTGGACGACGACCCGTTCACGTAGCACTCGTCCACCTTGCTGCAGATAGAAGACGCGGCCGCCACCGCCGAGTG
CACCGCCGTTACCTGCACGGCGACTATTGCAACCGTCACCCAAGTCGGTCAGTACTACATCTAGTACCTCTATCGAGTTCGTCATTAGCAACACCAACAA
GAACCGATCCACGCACCGGCGATCAAGGCGGCGAGGCAGACGTTGCGTCCCAACATGCTGCTGCTTTGTTGCGGGTTGATACGCCGCTGTTCACGACGTG
CAAGTGTGCGTCGAGGTCGCTGCGGAGAGGGGAGGACAACCGGTGAGCGCCACGGTCTCAGCAACAGTCGAAATAAGCAGCAGGGGACACTGCGCGGTGC
TCGACTATCACCTGGGCCGAATTTTTCCGGGAACGCACAGCGAGCGAGTGGGTTTGCTAATGGAGAGGAAGAGGAGAGGCCACACACACGCGCGCCAAAG
AGAGACTCGCCCAGCAAACTGGCTGTTTCGGCAACAGCTGGGGCGATATGTCTGGTCCGCTGTTCAGGCCATGGGGCACATAGTGGAGCCAAGTCTCCGC
CCGTTGCAGGTGCAACAGCCGCCCCGACCGAAGCGAAGCTTGTGGGGCAGCTTGCCTCATTTCGATGGCGAAGCTGCGTTACCGGTACAGTAAGCGCTGT
GACCTCGGCGGTAAATGACCCTTCACTAGATGATACGGTATCAGTGCTGTCCTGACATATACGatttaattttttttaaattaaaaaaGGATAAACGGTA
CCAAGCGCCTGCATGAGGGCAGTACTGTTGTTGTGTTGGCGCTGGTCTATCTCCGATCCTTCTTGCCGACCTTCAGCGAAGGATCTCAGCAAGTTTTACC
GGAGTCGAGATTTGAATCGATGAAAAGTTATTTGCAGTACAAGTTAAGCGACGGGATTGTCATACTACAGACGACTACATATTGACGACATTTGCACACA
CCGATCTCAATTTTGGTTTCGTGTGGACGAGAAGAGTGAAATCGAAGGAACATTTTTTGTCCTACACCAAAAGTTTCACTCGGTTTGCTGAATTTTAATT
TTAAAAAGAAAAAAGATGCGGAGTTCGATCCAACGTTATTACTACCAGTCTTGTATTGGCGATGCGCACCAAGGAGGCTTCAGGTACAACTCCAAACCGG
ACACTCGATGTAGTTCGGTCTGTAGAAGACATGTCCGAACCAATTTCTTCCATGCGTCAGGGCTTCGCCTTGATCAATAGAGCTCATCAGTGAGCGACTC
TTCGGTTGTTAGCACCTTGATTATACTGCACAACTCCTGAATATGGTGGCCATTACGTTGCCTTGCCGATAAACGATTTACTTCAACCAGAGACTTCCAT
ATCTCATGCTCTTACTATACCTGATGAAATATTTGTCCATCGATACTATCAGGTGTATCAGGTTAAATTGGGGAGCATTCCCCGCGGCCGAATGGTGACA
CTGTAGCCACGCACGACAAGACCACCGAACTTCAAAGTCATTATTACAGCAACAACCGCTGCCAGGTGAGGTTATGTGGACTGCAAGGCAACAGCAGTTC
GTAGTGCTTTAATACTGGCACCTGCAAAACCGCGTTGGATACTATTCATCACGGTAGTCAATCACAGCACGATTAATGCAAGGAGGGCAGCGACGAAAGA
TCCGATGGTCGGAAACAACACGCCATTTGCCGCACTGCTGTCGCCACTGCTAGATGACGACCCCGTTTTCAGGTCCGTATCGGCGCTGACGCCGAACGCA
GCTTCAAGTACGTTCTTGGCGGCTTGGTGCCCGATGTACATCACGAACGCGTACGGGTTGACCGTCCCCTCCTTCATCAGGCTGGCGTCGCTGATGTAGA
CGTTCTGCGTGCCAATAACTCGGAACGATGCGTCCGCGCACCTCGAAGCATCATCCGCATCGTCCGCCGCTGTGTAGCAGCTTCCCCCGAAGTGGTGGCT
AACGCTGCCAGCGTTCTCAGTGACCCAGCTCGCGATGTCCACATCACCACTGCCAGACGTGTTGCCGAGGAAAACAGACCCGGCGTCCGTCATGGTGGAG
ACCATCTTGGCGGCGTACGTCTCCATGGCCTCGACGTCGCCCGAGGTCGACAAGTACCAAGATCCGTTGGTGGCCACGTTGAATGCATTGCCGTCCACGC
TGATGTAGTCTCGTGACTCCGGATTGTTAATCAGTAGAGCGAGAGTGTACGCTTCGTCTGTTTCGTAGGCGTCCCCAAATCCGTGCGGAAGCACAGTCGT
CTGGAACTCGTATTCTCGGCCACTGATTTCCATGGTCTCGTAGGCCGTCAACACCGGACCTGGGATCGCCCATGGTCCTGTCTGGTTCTTCACGAACTGC
GCGATGGCATCTTCTGGTCGCTTGGTGTTGAGGAATGGCACCATCCCGGAATGTGTGAACGACGCGTACACCACCGCAGCATCAAAAACGGACTTGCCCA
CAGCCTCGTTGACAAC