Description :
From Genome Similarity Track
Location :
Scaffold_15:12203- 13503
Transcript NameFunction/comments
Physo_343531sulfhydryl oxidase, putative

Sequence
1300 bases(100 bases per row)
ATACAGCAGCGGACTTGAATCATACGCACAGCATCAATCTGCAATTGATGAGACGGTCCGCATGGCTACTTTTTGCGCTAGTCGCACAAACTTCAGTGTA
TGTGCCCCTTATGTGGTCAATACACTCGATTAAATCCGAACTCACTGACTCCTTGCGCATCAAGTCAGACACGTCAACTACATACCATGCCGCGTCTCCT
CCTCGTGACTCTGGCCGCGCTGCCGCTGCTTGCTGCAGCGCTATCCCCGCCGCGTGACCGAGGTCCTCTGTTCGAAGGGTCAACGGTAGTGAGCTCGCTG
GACGTAGAGGGCTACGAGGCCATGCTGAACGACTCGGCCTCGGTCTGGCTCGTGGACTACTACTCGTCGTGGTGCTCGCACTGCCGCATGTTCGGCCCGG
AGTGGGAGAAGGTAGGCGCGTTCTACGCACAGTCCGAGCTGCTGCAGGTGGGGGCGGTAGATTGCAACCGGCACAAGGAGATCTGCACGCGGGAGGAGGT
GCACGCCTACCCTACAGTCAAAGCCCACCATGTTCCACTCAAGTCGAATGAGAAGGTGAGCATGGAGGCGAGAGGACGGAAGACGCTCACGTCGGTGGTC
ACGTGGGTGGAGGACGTGCTGAAAGAGCACAGTATCGAGTCTGGGGTGGACGTGTCGACTATCGCTGAAGGGAACAACAATCTGCGACGGAATGACGGGG
AAGAGGCTGAGACCGCAGCGTCGAAAGAGATTAAGGACGATACGTACGCCCAGATGAAGTATAACCGCCTACTGGATGCCGGTAAGGCTGTGATGCTCGC
TCTGGAGGAGAGCTTCTTCATTGTTACGCCGGTGCTGCAAGGCGAGAGGTACGAGGCTGCGCTAAGGTGGGTACGCCCTCGCTGTGTCGTTCCCAACGGA
GGAGAACCGCGCAGCTATGGGGAAGCTGGTGGATTTGATGAAGCAGCAGAAGAGTTGGTCCATGGATGAGTGGAGAGAGCTCCTTAAACGATGGAGACCT
GTTGCGAGGGAAACGAGCTTCCCTACTGACCTGTTTGACCCCCGAGGAGACGACGACTTGGGCTGGGAGGTCTGCAAAACTTACACTTGTGGGCTGTGGA
CGCTGTTTCATAGCATGACTACGAGGGAGTTTAAGGCGGAGGAGGCGTGGAAACCGAGTGAGACCATGGCGGCGATTCGACTGTACATGAAAAACTTTTT
CGGCTGCAAGGACTGCCGCGATCACTTCATGGAGGCGAATCCCGAGAGTTTAGTGGCCGAATTGGCCGCCAGCGACGCGCACGGACCACATGCGGTTGTG