Description :
From Genome Similarity Track
Location :
Scaffold_188:12202- 13992
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_188-fgenesh-gene-0.7Cullin-associated NEDD8-dissociated protein
Pytve_DAOMBR484maker-pve_contig_188-snap-gene-0.14EML5 (ISS)

Sequence
1790 bases(100 bases per row)
TGGGTGGGTGCTGGTGCACAATCAGTCCGCCGTTCGCTCCTGGGATGCGCTTCCGGGTTTCGCGAAGCAACTCCGTAAACACGCCAAGGACATCGATACG
GACATTCTCCTCGCGCTCTTTGAAGCGTGAGATCAGCGGCTGACTGAACTTGGCGTAAAACTCCTCAAGGATCTCCGGCCGAGTTGTAATGACCGCCACC
AGAACGCGGAGTCCAGCGCGGCGGACTTTCCAACTCGTGTCATCATCATCGCTGTAGTCGCCTTCTTCCTCACTGTACTCTTCCTCGTCCTCGTCCATGG
GTTCGTCCTCGTCCGCGGAGTCGCCATAGTTGTAGTTCGGGTCGTACTGGATGAACAGCATCACGAGGTGGATGATCTTCTCGATATGAGGCGTGATCTC
GTTGTGGCACCGCACGACGAACGCCTCGAATGCCTGGAAGCAGTTGCTGCGCAGCTCATCAGATGCCTCGTTCTGCATCGACTCGTCTTCCGGGTCGCCG
CAAAACTGAACCAAAATGTCAATCACTGCATCCAAGTGTCGTCCCAAGCGGTGTCCTGCTGTGCGAGACAGCGTGCCCGTTGTCTGAATCAAAGTGCGCA
CATCCGCAGAGTCGCTCGCTTCGCGGATCCCCTTGATTAAATGCTCAACGAGACGCGTGACGAGCACATCGGATGCCATCACTCCCAGCGACCCAACACA
GGCCGTCGCGCGCTTGCGGACCAATGCAGACGGGTCGCTCAGCTGCACCATCAGCAGGTTCATAATGGTTTCGTGCTCGGTCGCAATGTCGCGACCGAAC
CGCCGCAGTAGATCCGTCAGGATATCCAGCGTTTCCGCCTTCACCGCCGGATCCTTGTCCTTGCCCAACCCGGCCAGCAGCCGCGAACACACATTGGTCG
CGACAGCAGCGCCCGTCGCTTGCGAGACGTCGGACACGATGGTCTTCAGCCCAATCGAGTAAATGTCGCGCAGCTCAGGCTTGCCGTTCAAGATGAGGTC
GCACAGCTTGGCACTGATGTCGGCCACCTGCGAGACCTGCACCTTCGTGACCAGGATGCCCAAGCTGGATAACATAGTGCCCACAGACTGCCGGTTAGAT
CCACATCATAAGGTTGAGTTGGCAATCCACCACAGACCATCTCACGGCGATCGACTGCACGTCGTTCGACTTGTCGTCCAGCTGCTTCAAGACGGCGGCG
CACACTCTGCATTGCCAGAACATGTGAATATCCTCCCCCCACATCTTCACGAACACCCAGATACTCACTTCGGCTCTAGGTACGGCCCCAGCTCCGCGTT
CTTGTTGAGCTCCGTGCACAGATCCGATGTGGCCATGTACCGCTCATCCTTGTCGAAATCCGTCGTCTAATTCAGCAGCGACCAAAGCAGCACAACGCCA
GTCGGTCAGCACACAGCGCAGCGACACACGGACCGCCAGACGACCGATGCCAATAGCACCCACCTTGTCCAGCAGCTGCGCGATCTTCTCCTCGTTCCCG
TGCATCTTGGTCAAGTTTTGCTCGCTGCAAAAGGGAAACTGGGAGATTGGGTTGGGTCCATGTTCCCGCCCGTGCATGAGGTCATGGACTTTATTCTAGG
ACAAGATGCGCATCCCACAGTTAGTACACTAAATGAGTGATTAGGCGACCAGCACTCTCTCTCACTCTCGATGGCACCTTCAACATACGTCTCTTCGCGA
CACTGCCGCCTCCAACCCAGACAGCCGCTCGTAAATACAAGCGCTATCGGGTGTTGGCGTCGTCCGAGGGATTGCCGCAAGAGCAGATGA