Description :
From Genome Similarity Track
Location :
contig_82:122015- 123886
Transcript NameFunction/comments
g10260.t1integrase putative

Sequence
1871 bases(100 bases per row)
GCGTTCAACACCGACCGAGAGTCTCGCCAGTGCACGTACTGCGGGAAATTGGGGCACACGATCAACAAGTGCTGGACCAAGCAGAAGGACGAGAATCGGG
GCCCAAGACGCGGCGGCAATGGCAATGGCCGTGGACGCGGGGCCAACAATGCCCAGTGGAGGAACGACGACGCCAACTACGACTACGGCTACGGCTATGA
TCGAGTGGCGTTCGCGGTCTCACTGGAGTGTGGCATTTCGACGGGCAAGGATATGCTCGGCATGTGGGCGGTCGACAGCGGCGCAACGCACCACATCTGC
AACGACAAGGCCAAGTTCGCCCATTTGATTGAGCGAAACGAGGGCGAACTTTCGGTGGCCGACGGCAACAAGGCGGCCATCATGGGTGTGGGAACCATCG
TGGAACGAGTGGTTCTGCCCAACGGCGACGAGCGCGACATCGAGATCAAGAACGCGCTGTACGTGCCGAGCATGAGCAAGAATCTGCTCTCCGTGCCACA
GATCAACAAGAGTGGTCTGTTCCAAGTCGTGTTCGACGGCGCCCAGATGCGCGTTGCGCACAAGGCCTCCAAGCAAGTGGTGGCGGCGGCGAACCTCGTG
GATGGCCTCTACTGGATCCAGACGCCTCAGCGATCGGCGAATGCAGCGACCAGTGGGAAGACGGTCGACCTGCACGCGCGTATGGGTCACGCTCCGGTGG
AGGTGCTTCGCAAGATGATCGACAACGACATGATCAAGGACGCGAAGGCACCTTCCAAGTCGAGTGGACCAAGCGTGTGTCGCGGCTGTCAGCAAGGGAA
AATGGTCCAGAAGCCGTTCCCAAGCAACCGTGACAAGCGCCTACGACACGTTCGAGCTGCTCCACTTCGACATCTGCGGCCCCATGGAAGAAGAGTCTCT
GGTGGCAGCAAGTATCTGCTGCTGATCGTGGACGAAGCCAGCGGATGCATGAAGGGGTTCTGCCTGCGTGCCAAGTCGGAGAGCGAAGACTGCATCAAGA
CGTACGTCACGAAGGTGCAGACGCAGTTCGGCAAGAAGGTCAAGTTTGTGCGGCACGACGGAGCTCGTGAGTTCGCGACCAACTCGCTCAAGGCCTTCTA
CGAAGTCGAAGGCATCGAGCAGCAAACCACGGTTCCGTACGCGCACCAGACCAACGGCACGGCAGAACGCGCCATCCGGACCATCGTCACGATCGGCCGC
AGCATGCTGCATCACGCCAAGTTGGACAAGTGTTTCTGGGCTGAGGCGGCCATGACGGCCATCTACGTGAAGAACCGCCTGCCGTCACCCAAGGGAGCAC
AAGACTCCATTCGAGATCGTGTACAAGTCCAACCAAGTGTCAAGCACATGCGTGTGTTCCGGATGCCAGACGTACATCCTGACGCCGAAGGAAAAGCGGC
GCAAGTGGGACCCCAAGGCTCGCGCCGGTTGTTCCTCGGCTACGAAGAAGTGTCCAAGGCGTATCGACTTTATGACATCGAGGCGGGGCAGGTGGTTGTC
AGTCGCGATGTCAACTTCGATGAGTCGGCCTTTGGACTTTCGGCGCATACTTCGGATGAAGACGTCGATGATGCTGCGCTGGACCTGGACGCGCTGGACC
TGGACGACAACGATGGACCGCGCCAAACGAGCTTCAAGCAGGCGGGGAAGCGCAAGAGCCGACCGAGTGGCGACGACGACACTGCCAGAAGATCGCGCCC
CGTTCGCCACCGAGCTGGCTTAGAAGAAGCAAGTGCGCCGGACGTATCCTCGTCGCGCCGAGCTGAACCCGACGAAGAAGAAAAGTCTGGGGACCAAGAT
GAAGACGACGACTCGACGCCTCCAGTGTTTTGGCGTGCCAGTGCCAACGCTGTGGAAGCAGCAGCCGATCT