Description :
From Genome Similarity Track
Location :
Scaffold_284:12201- 13380
Sequence
1179 bases(100 bases per row)
ATCTGAAGAAGTTCCTCAAGGGCGACCTGGATGACTTCTCCCGGCTGGAGATTCGCAAGCTGTCCAAGCGGGCGGACCTATTTGCGTTGAACGTTCGGGA
TGTGCTCTATCGACTGGTCAGGTCTAATCGGGACCAGCCTCGCGACAAGACCGACGAGTTGCGCCTACTCGTACCAGAAGTACTCTGTCTGGACATGCTG
CATTACGCCCATGAGGATTTCCAAGGTGGCCACCAACGAATAACCCGGACGCACAAGAAACTCCGGCTGGAGTTCTACTGGCCAGGGATGTACGCAGATG
TTGAAAGATACGTCAAGGAGTGCACCGACTGTGCCAGCGGCAAGGAGCGTCCGCCCAACCCTGGACCTTCGCCCGGGGACATCGAGCCCAGAGATCCTTT
CGAAGTGGTCTCGATGGACTTCGTGACCCACTTGCCGAAGTCCGAACGGGGCAACACGTTCTTGCTCCTGTTCCAGGATGCGTTTTCGGGTTTCGTGATG
TGCAAACCGATGAGTTCTACCACCGCTCAGGATGTCGCTGAGGCATAGGAGGAGAGGGTGTTCCGCTGCTTCGGAGCCAGCTCCCTATTGCGTCATGATC
AGAATCCCAGGTTCATGAGTGAATCACTCGGTTCAGGGAACTTCTAGGTAGCCGATAGCGAGCTACGTTGGGGTACCGACCCCAGACGAATGGACAGCAG
GAACGTTCCGTCCAGACTGTGGTGAGGTCCATCCGGGCTTACAACGCAGAAGCTGACCAGAGCGACTGGGATGACCACGCAGAGAGGCTCATGTTCGCGC
TCAATACGTCGTTTGATGCAACCCGGCTGGACACCCAATTCTACCTGGTCCACAGCTGGGACGCCAAGAGTACGATCTCAGCTATGCTGGGGCCTAAACC
CTCCAGTGTCCCCGAACGGACCGCGTATGAGTGGCGAAGGAAACTCCAGCGGCACTACGGCTACGCTCGGGCATGTGCAGAAGGCCTCCAGAGGAAGGCC
AAACGGGCTCGCTCGGAAGAGCAAACCCGGAAGTGGAACGAGTTGTCAGACCGGCTCAAGGCAGGTTTCAACGTTGGGGATGCAGTCTGGCTGTACATCC
CAAAAGTGCAACCGGGTCTGAGTCGCAAGTTGGCCCACTTGTGGCATGGTCCATTCAGGATCGCCGAAGTGGTTGACGA