Description :
From Genome Similarity Track
Location :
Scaffold_2077:122- 3873
Transcript NameFunction/comments
Phyta_totarag14081hypothetical protein

Sequence
3751 bases(100 bases per row)
GGCACCCTGGTTGAACTCATACAATAGTGCTCCGCAACTGAGCTGCGTGACTGGGAGCCACTCTGGTTCATCATACTCCTTCCATTTGACCAGGTATTCA
CGCTTCCGCTTGGAGGTGCGGGTCCTCTTGGACCAACGCAGATCCAGaatcttctccacttcgaaATCGTTGTTCAGATGGTCAGGTTCCCAACTATCTT
CCGGAAGAAGCGCGGCATCGAaatcgtcttcttcatccacatCTATTTGGACAGTGGGCCGTTTCGGAAACAGAGCACGCGGCTTCAGACGACTGATGTG
TACCCAAGGATTAACACGATATCCCGTGTCTTGAATCTTGAGTTTCACTCGGAAATCATCATGCACTTAATCAATGCGGAAAGGTCCATGCCACTTGTGA
GCGAGCTTCCGGCTCAAACCCGTCTGAACTTTCGGGATGTACAGCCATACGGCATCTCCCTGTTCGAAACCGGACTTGATCCGTTCAGAGAGCTCACGCC
ACTTCGCCGTTTGGGCCTCCGATCgggccttcttcgccttcttctgtAAGTCTTCCGCACATGCTTGCGCATAGCCATAGTCTCGTTGAAGTTTGCGACG
CCACTCGTAGGCGGTCCGTTCGGGTACACTCGAAGGCTTGGGTCCTAGCATAGCTGATATCGTTCATTTAGCGTCCCAGCCAtgcaccaagaagaaaggc
GTATCCAACCGCGTTGCACCAAACGAGGTGTTCAGAGCAAACATCAGACGCTCAGCGTGTTCGTCCCAGTCGCTCTGGTCTACTTTGGCAACCCACGCCC
GGACACTTCGAATGACTGTCTGAACGGATAGCTCTTGTTGCTCATTGACCTGGGCCGATATGTGAGCGTGGCTCGCTGCTTGCTTCCCAATAGTTCTCTG
AACCGAGTGGAAAATTCACTCATAAAGCGCGGGTCTTGGTCATGTCGGATCATTGAGCTTGTTCCAAACCGCGTGAAAACACATTCTTCATACGCTTCTG
CCACGTCTTGAGCCGTAGTCGAGCGCATGGGTTGCATATTACGAATCCCGAGAATGTGTCCTTGAACAGAAGGAGAAAGGCGTTTCCTCGGTCCCACTCT
GGCATGTGGGTCACGAAATCCACCGATACGACTTCGAACGGACGCCGGGGCGCGGTGTTCACAGGCGAAGGTCCGGTATTCGGAGGTCGTTCCTTGCCAC
TAGCGCAGTCTACACATTCTTTGATAAAACCTTCAACATCAGCGTACATTCCGGGCAAGTAGAATTCCGAACGAAGTTTCTCATGAATTCGGGTTATCCC
TTGATGTCTGCCTTGATATTCTTCGTGAGCATAATGGAGCATATCCGGACGGAGTGAGCTTGGAACCACTAACCATGGTTCAGACACGACATCTCTGGGT
CGATCTCGAGTGGATCGGGCGAGCCGATACAACACATCTGTCGTGTGCAGAACGAAAAGGTCCGACACCTTGCTAGGCGAGAATTGGTCTACTTCCCCTT
TCAGAAAAGCTCGTATCTCGGTCAGGTGactgtcttcttcttgatgcacCTTGATACGTCACCATCGCTCTGATTGTTATTCGAGCGGGTTCATTGGCAC
GCCATCCTGAACCACCCACGACTCTCCAAGAGCTAAAGCCTTGTACGTCAAGTAGTCAACAGCTTGGTTGTAATCATGCTTGACATGTACCAGTTTGAGT
GACTCGAACTTTATCTTTAGAACCTCGCACTCGGCTAGACGTCTCTGCAAGTTCGGCTGGTTACAATTGATCAGACCTTGGCTGAATGACGATCCTCGAA
TCACCAACGGGTACCAGTGCCTTATTGTTCCGCTCGGAGGCCATTGCCATCCCTTTCAGAAGTCCATGATACGCAGCATCATTTACAGTGACGTCTTCGA
GAATATAACCGCGTGCGTCTAAAATGGACCACCCGGGGAGCTGCCACAAATACAACCGCAACTTCCCTGCTGGGTCGACGTCATAGCAGCACCATCGAAA
CTGAGGGCAATACCATTGTAATCATCACTGAGCATTTCCACACTGACAACTGGCGGTGCCTTGACACGTCTCTTGGCTGGAATCAGTGATCCTGCAACCT
CGTCTAGATGCTCACGTGGCGTGATACCAGCTAGTCCATCCTCATCCCGTTGCACTTTTCGAACTTCAATGTCCCAGTGAGACAAAGCAACCCACGGTAC
ACACCGGCCATCGGCCGTCTTCGAACGAAGGACCCACTTCAGAACCGAATATCGAGTATAAATCTCCAAGTGAGAGAGTTCAATCAATTGTCGAAAAACT
TGAAACACTCGCAACATTGCGGTGACTTCCTTTTCCGCAATATGGTAGTACAATTCAGCATCGTTCAGGACACGACCAGTGAAACGCACCGATCGGATTC
TCCCGTCATAGACCTGTCCTAACACAGCACATGCTGTCCATTGATTCGCGTGCGGAATAATGACGAAAGGTCGGCTCCGATCAGGATGATGTAGCAACGG
CGTCGAAACAATCTTTCGCTTCAGGATCTCAAATGATTCTTTTGCTCTGTGCAAGTTCTGTCCGGAACGTACTTGTTCGTCCGTAAGCTCTCACTGAACG
GCAACCACCACCGGAAAGTCTTCAATGAACTTATGATAGTAGTTCAGACTTCAGAGAAATGACTGGACATCTTTCAAAGTGTTCGGGAAAAGTAAGTCCT
TCACACCTTTTGCGATCTTCGGCGTTGCGCGTATCCCTTCTGCACTGATCTCATGTGCCAGGTACAGAATCACCAGTTTTCCGAACTCGCTTTTGGGCAA
GCTCACTGATATACTCCAATGCCGAAGCCTGAACAGGAGAGCATTCAGATCCTCGCACAGCTGATACCAGGCCTCGGCACCACGAACGATGTCATCAATA
TATGAGCTTCGTCCCATGACAGGGTCCATTTGAGAAGATGTAGGGATGTTCCGCTTGAACACCATCATCCGGTCAGTCAGGATTGGAACAGACTGTTCAG
ATTTCCCACGCTTTGAGTCATTTCGTTCTGACGGATCCAGGCCTAAGTATTCCAGTACATACTGGTCCACTTTGGACTCTTCTTCAGAGGGTAGTCACAC
GAACCACATAAGCAGTTGTTGATCATGGCTTGATAAACTAAAGGAGCGTTCTTGAGTCCGAACGGCATACGTATTCATTAGAAATGTCCGAATGGGCAGG
TGAAAGCTGAAACCAGCTTCGCCCACTCAGACATCATAACCGCCCAGAAGCCGCTTGCCATGTCGAGACTCATGAACCACATTGCTCGTTCGAAACCAAG
CAGGAGGTCATCGATCAGAGGCAGCGGATAGTTCGATAGCTCGCTGAAGCCATTCACGACTCTGTAATCAATACACATTCGGATGTCCACATCATTCTTC
TTcaggacgatgacgattGGGGAAACCCATCGTGAGCTGGAATGTTCTATCAGACCAGTCTCCAAACGTTTCTTCAGCAATTCGTACACCTTCATCGCTA
GGTGCGGTGCGATCGAACGGGGACGTTGTGCAACCGGTTTCGCGTTACCTACATCCAAATCACATATTACCCCTCGAGCTGGTGCCGGAGCTGCATTTCC
ATCTCCTAAGAAAATGGATCGACGATACTTCAGTATGGACTTCAGTTTTCGAACTTCGTCAGGAGATGATTTTCCCGGTACACTCACATCTGCCTTGTCG
ATGTCACAGGTCGGACTCAGATCCTGTAGTTCCGGTAACATGGCCAACTGA