Description :
From Genome Similarity Track
Location :
Scaffold_2268:122- 2843
Transcript NameFunction/comments
Phypl_g14892hypothetical protein

Sequence
2721 bases(100 bases per row)
AAAGCACAATACTTACAGTTAAGTAAGTACATGTTTTGGGGCAATTCTTTGaattttagatccagagtatctacaggcgagtagctcgacccaaagTTAC
TGTACATTCTTATACTCATACGCTACCCAAACTAAGAACTCCATTCATTACTCAATCTTAGCTACCCAAATTTAACTTATAATCTAATGCACCTGTTATC
TCAGANGCTAGCTGCAACATTCACtgggtgaatgttgcttgaagaaaggTGGGTGGAATCGTTTTGATGCTGCATTTTATAGGTTAAATTGCACCCAGCT
CGTGGGTGGACTGTATGGCAGCTCGACTCAGcctcagctcgagcttccgcgtgCATGATAAAAATGCATGGGCGCcgtcaagttgctgatcgCAGGCCTT
CGGATTGACGCTTCGTTTTTTATATAATATATGCCTGTATTTTAATATACAAGAAGGGGAAAGGTAAAATGTCTAGAGAGAGAATAGGAAAGGAACATGT
ATTGGGAGTTAGCAATGTTGACGGACTACTGCTAGCGTTTCACTAGTAATTCGAGGGGAGGAATTCTTAAACATGAAtctgtgcttcagcttgtctgcCG
ATTGTCGGCcagcggaagaagctgccacaTCAGGGTTTGCGCTTTttcatcgtcgccaccggcatcttgtcgtagacCTCGATCATCTCCTCCGGGACCG
GCTCGCTGCCCTTGTCGTGTCCAAGGGACTTTTTTGTGCGCTGTGGCCCGGCACCGCGCTTTGGTTGGGCCCGGCCCATGATTTTTAATGCTTTTGTATG
TGCTCTGACtttgaaatccagagcttcaccgtgtgtaagcacggcgttagtCTATTTAGGATGTGTTTGCCATAATTCGTGGTATTAATCCGACCAAAGT
AGGTAAATATGGGTCGTAGGTAGCAGTCTAAATAAGACTAGTCGGAACGAAACGAACGCGAGGTACGCTGCAGGGAGAGCTGTGGTTTTGCACTATGCTT
ATGAAGTTCCTTGCCAGTGTGTTGGCCACATTTTTGGCATCAGTGGATGGACAGTGCTTCacggagactttggcgagTGTTTGCTTTCGTCTGGTAGTTT
TATAAATGTGATTTGTCCCGAATGCCGAATTCAGCGCTGACATTCCAACCTATttagagcatctccaccgcgACCCTCAAACTGGGATGACAGCAAATAA
ATTTCCTGATCGACAGCAAACGAAGCCGATTTGCTGACAAATTTGGTGTTGGCAGCAAAACGGCGGTGTCCGATTAATCCCTGTCTCATAGGTACATTTT
ACATTGGAACTTGGGCACTTCGGCTGGACAGCCGGCCACTGCCCTTTGATATCTTCGCGCGCACGCATTGCATCTCTCACCAATTCCACCCGCGAATGAT
GATGGAATATCTTCGCGCGGTCCGAACTGGGACCATTCAGAGGACAAGGCGCTCGCCAAAGCGTGGCTGGTGGTGtcgagcgacggcatcgtgggCACTG
ACCAGCGCGCTAACCATTTCTGGGAGCAAGTGGCGTCGAAGTACAATGGGATACGGCCTCGCCGTAATGCTCGGTATGAGTGCACCCAGAACTCCGTGAT
GAAGCGCTGGCAGCTCTTACGTTTGGCCGTGGGGAAGTTTTGTGGGTGCATGGCTGCTATCGACCAGCTCAATGAAAGCGGCAAAAatgaagaagatcgc
gtCGAGGACGCCATAAACAtgtacgagcagctgcaTGGTGACAGCTTTGAGTACCTCGCGGCTTGGCGAGAGCTTCGAAAGGAGCCAAAGTGGAAAGAGC
TGCCCGCCGCCAACAATGCCAAAACAACCAGGAAGCGCGTTGCCAACCAGGGCACCGCAACGACCAGTGCATCCGACGCTGCGACGTCACGGGAGACAGC
TGCACCGACTGAGAGTAGCAAAAGACCCAAAGGAGTCAAGGGCACGTTCCCTGGAAGCAAGTAACCATCGGATGGCAGATGCAGCCGTGGTCATGGCCAA
AGCCACGAAGCACAAagctgagctggaggaaGTGCAGTTGGAAGGCTTGGATGAATTGTCCGTGAGAATTATTCGCCTAAAGAAGCAGAAGATTTTGGAG
AAGATAGAACAGGCACAACAGCGGGTTCCAGATGGGGACCACGAAAccagccaagaaggcgaCAGCGAAAACAATCCAAGGGACATCAATGCTTCGCGTG
CAGGTACGGCATTCTTGTTTGGCTGATTATTGATCACTCATTCGCTAATTCCTACATGCTATTATTACCCTTCAGAGCCGACAAGTGGTCAATGAGGGCT
TTTTTAAGGCGTGTTGGGCTGTCGCCGACTGAAGCTCGAATCGTCTTGTGATAAATCCTCCCACATCCATTTGCTCGTCTCTCACGCGTGTGCCGCCGTG
GCTAGCTCGTGATGCACTCGAAATATCAGTGGCATCGTCATCTAACGGCTCCAAGTCGGGCTCCTCCCATTTATCATCAATGATCATGTTGTGCATAATT
ACACAAGCCTTGATGAACGATAGCATGTCCTCAGCATACCAAATATGGTTTGGCATTTTCAATATGCGAAAGCGTGACTGCGGTACTCCAAAGGCACGCT
CAACGTCTTTCCGTGCTGATTCTTGCTCCTACGGAAAATTATTTTCTGTTGACTATCCGGGGCGCGAGATTGTCGGCATGAAACACGCATACGACGGATA
GATTCCATTGACAAGATAGTA