Description :
From Genome Similarity Track
Location :
Scaffold_470:12198- 14071
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_470-snap-gene-0.10Hypothetical membrane associated protein
Pytir_DAOMBR486maker-pir_contig_470-fgenesh-gene-0.6Zinc finger CCCH domain-containing protein 17

Sequence
1873 bases(100 bases per row)
AGCTTGACGCTTTGACGGCGGGCAGCATTGTAGCAGGATCGTCTTTGAAGAAAGATGGCAAAGGACGTTGAAAGAGAAGAACACCCCCGAAATACCCCAT
TCGTACTTTTAGATTACCATTAGAAAGTGAACATCAGAAAAATGGGCAGAGCTAAGTGAAGAGAGAAGAAGGTTTTGTGTATGCTGTCGATGGCATGTGC
GCCTCTGGTAATGCTATTTGCTGTTGTTACTCTTTGTTCACGGTTAGACTTTGGTTGTCTGCGTCTATTGGTTTCCTACAAAGGGTTGGCGAGGGTAAAT
CCCCCACCCAACCGAGCAAGTACTCGCCAGTTTGCTCTCTGTGCCCTACTACTAAACTGCCTCTTCGTCTTCGCCATCGTTCTTCTTCTTCTTGGTTCTT
CATTTGTGATTCCGTGATTCTGTGATTCTTGCAATGAGCCAACCCCGGAGTATCATTCATCTTTCAGCAGGAGTCTACAGGCCACAAAGGACTGGAGTGG
GCTGGCCCACCCGCTTATTGCTTTGGCTGAATCACCGTCGAGTCGCCCGTGATTTGCCACGCGAGCATTTTCCGGTCGTTGCCGACTGAGAAGAACGTAT
TCAGCGGACCGATAGCGATCCGGCGCACGGCGTCCTGGTGGCCGATATTCGCGGCCCCCGACAAAGTCGTCTTGTACGCGAACGTCGGGAGCTCCTTGAT
TGTAATCGAGCCATCCTGTTGGATGCAACGTTGTAAGAATGAGCCAAATGGTAACTCTCAATACCAATAACTCCTAGAGACCTATAGACTCAAGCGTCAA
ACTTACCGAAGTGCCGACTAGGAGCACGGGGGTCTGCGCGCCGTCCTGGGTGCCGCAGATCGCGGTCACCGGATTGTCTTGCGTCTCCTTGAACACCTGT
TGGAAGGGCGGCGCGAGGCTCCACACGATGATCTCGCTGTCCAGGCCGCCGCTGATGAGGAACGTCTCGCTCTGGTTCACCCAGAACTCCAGGTCCGTCA
CCGCGTTCGTGTGGCCGTTGTCGTCGGCCGCCAGCACCTTCACGCACTGGTACGTCGAGAGATCCCATAACCGGATCGTTGTGTCCATGGAGGCGGATGC
CAGGCTGTCGTAACGAGTTTGCAATAATCAGTACCTAGATGCAGTTGTCATGGCATACAGGAACCATTTACAACTATCACTTACATTGGTGCTGTGCCGA
CGACAAAGGTCTTGAGGCGCGTGACGCCACGCACGTGGCCTTCCAGTGTGCCGCGGCATTTGAATTCGTTTGTAGTCGCATCCAGCTGCCAGTAGCGGAT
GAGTCCGTCCGAGCCGCCGCTGAACAGCGTCGCGTTTCCCACCGAGTCGGTCGCGACCGTGAGCGACATGACGCTCTGCGAGTGCGCGAACGGCAGCGAC
TCGGACACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGATTCCAGCCGCGGATCATGCCCACCGGCAGGTTCTTGTTGA
ACGGGAACACGGCCTCAAAACCCGCAAACAGGAATGGACCGGCGAGCACCATCGCCGCGACGCCGTCGCCCTTGTTGCTACTGCTGCTGTTGTTGTTGCG
TCCGCCGCTCGCGCTGCCAAAGCCAATGGAACCACCGCCACCGGCCGCATCGGTACTCGCAGAAGAACTCGCGTCGGCCACGCTGATCGTCGAGATCTCG
TTCCATGACGCGCAGTCCCACCACTTGATCGTCGAGTCCATGGAACACGTGAAGAGCTGCTGGTGGGACGCCCAGATCGCCACGTCCTTGATCGTGCCGC
TGTGGCCGCGCGTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGCGGGAATCGGCACGGACGCCTGT