Description :
From Genome Similarity Track
Location :
scaffold_25:121961- 123818
Sequence
1857 bases(100 bases per row)
TTCGATACGAAATTAATCGTGAACCTGGTTCAAAGTATGCAGTGCTTtgacagtggccactgtaGCGTGAGTGAAGCGAGTACAGCAACAAGatttttgc
tcaaaagcaaaTTTCTGGCCTGATAAGGGAGTGTTAGTCCTCCCACAGCGCACCGACGTTTTGTGTATGTAAACCAAATGGTGAATAGCGTTTCGTTCAC
GCCTATAACAAGCCAAATGCACAGACGATCCCTGCGCAAAAGCCGAAGCCGCGTACGGATGTCATCAACCACCAATTAGTGTacttgatttggtcgatAG
GCATTACCAAATCGTTATGAGTGAAGAGTACGTCTCATTGAAAAGTGTAAGTACACCGTCCGGTATGTtatgggagtggcttgtgatgccacaGAGCCTA
TGCAATACCCCAGCAATGTTCAATCGATTGGTGTACTATCTGTTTCGACTTCgcgcaaacatacttcgacaatAATCTCGCTCACTCGAAGGACAAAGAT
GGCAGACTGCCACAAAATATACACTTGAGATACCTCCGTGTGGTGCTAGAATGTATGCGCGAACATCCATTGCAAATAAATCTTACGAATTACCCGTCCT
CGGTTGTTATGCTGGTGAACACGGTATTCGAACATATCCTGAGTAAGTCAACGCAGTCGTGACCAGCGGCACGAAATTAAAAGGATTGAAGGAATCGAAT
TGCTTTGTCTGATTACCTGCATCGCTTCTCGCAAAATTACGCGGAAAACGTACGCCAACATCAACCTTGCTGAAGAAGGCCGTTCCATAAAAGTGGTCAT
CCACTAGTGAAGAAGAAACCAAGAACAGCGTGATGGAAGCTCCATTACTAGCAATACTAGATGCTACGAAGCCGTATAGGGTGGAgtgtgacgcttctga
gtttgcaatAGGTTGTGCATTATCGCAAAAGTACTATGAAGGACACTGTCGTGTCGtttcaatcgcgacagctgaagccaGCAGAAAAAACTACTCTGGG
AGCTTTCAGCAATGAAATATGCTCAAATGAAGCATCGCGTTCACCTCTTGGGTTCAATCCTTACAACTTCATGGTCGTGTCCAAACCAGGAAGACTAAAC
ATGCTGGCAGAATCATTGTCACGCCGTTCTGATTATGATATCAGCTATATCGAAAACGATGTATTTGATAAGATCCATCGAGCGTATGCTGAAAATGAAC
AGTGTGATTTATCAGCGCAGTGTCATCGAAGATATATAATTCCATCACAATCTTCCTGGTCGCTCGAAGTCTAGGTTGCATCGTTATGCATGGAAGAGTA
GCCTCCTTTACTATGAGCTAGGATGTTGCACGTGTCGACGAGTCACGGATGGCGCATGATACGCCGATGGCCGGTCACTTTGACCGTGAGGAGATCAACC
TGCCACATTATGGTAGCAccacatgtacaagtgggtgGCATGATACATGAAGACGTGCAATGTCTGTCAGCGCGTGAAAAGTGTATGGAACATGCAAGCT
TCACTGCTGCGGAGTCTTCCTGCTCTTTTGACTGTTGGAAGTCTGTCGGTCTCGACTTTCTTCGAGAATGCTGATGGCCACAATGGGGTGCTCATCTTTG
TtgacagactcagcaagatgattCTCATCGCTCTGTCAGCGATTCCAAAAAAACGAAGATCCAGCGAAATTGTTCGTTGatcacgttctttgcagccacA
GGTTGCTAGACGCAATCGTCTCTGATCGTGATACACAATTCACTAGTGGCTATTAGAAAGAATAGTTTTGAATGTTTGGCACTCGCCTGGATATGTCTAC
ACCGGTACACCTGAAGACCGTTGGGCATACACAACGTGCCTACCAAGCGGTCGGTTG