Description :
From Genome Similarity Track
Location :
Scaffold_13:1219411- 1222025
Transcript NameFunction/comments
Physo_532262Hypothetical protein

Sequence
2614 bases(100 bases per row)
GCTTGACCGGCGATCGTTTCTCCTCTCGATCAACCTCGATCCCGCTATAGGAAGCGGCAAGCAACTCAGGAAAGGAAGGAACACACCCGGAAAAGCGACT
ACAGGCCTTGGATCAACTCCAGGCCGACCGATCGGAGCGAACAACCCTCGATCGGAGCGTATACTCGGACGCAGAGCGAAGACTACCGCGCTGCCCCACA
AACTATCCCCGCGTCACGCCAAGACACTCGATCTTCACCAAGTTCTGCATCTTCGGAGCCCCGAGAGAGCATATCCAGCCCGCCGACGGGTACACAAGGT
GAGAACAAGTTCAGCCGATCACGGATCGTTGGGGGACCCCCCTCCGTTAGTCGGTGTCTGGGCGCTGGTGGGAAGCTCGATCAGGCCTTAACCAGATTTT
GGCCGATCCCGCTACACCACAATGGTGTGCGTGCCCGGATTCGAACCAGGGATTTCACCGTGAGTCCGTAGAAGATGCGCAAGTGAAGAAAGAACCAGGG
GAAGAGGCGTCGTCGGATATCGGATCAACGAAGACGCTGCTGAACAAAACGAGATCCGCGGATCGACAGAGTGCTCGGAGGACTTCTGTCGACGGAATCG
AGGGCGATCTGGAGACAGATCTAGAAGACAAACCTCAACATCCTCCACAGGTCCCTTCGGGGACCCCGGTGGATCTTGGTGCGAACCGAGATTCACTAAC
AAAACAAACTAAGGCGGGATCAGACCGATACGCGTTCGCCGACTCGCCGATCAGGCTCGATCCGGACTACCTGGACGCGATCGCGGACAAGGACCAGATT
GTGAGGAAGAAGCTGAGAGCGCCAGGCCTGGACGACGAAAATCCCAGACCGTCGGCGCTCGACTGGTCCGAGGCTGACCTGGATCGTCAGTATCACTTGA
AGGAACTGCGAGACTTCTTGCGTCAAGATCCCGTCATGGTGATCTTGCGGCCAGAGCAGATCGACGACCCGAAGGGCCCGATCTCGGCCCCCCGAGTGGC
GGACAACAAGCTGATGGCGGTGAAGAACCTGCTCGGACTGTTGAAGGAAGCCGGCTTCGTGGCTGGCGCCTTTGAAGCGAATGATCTTTTCGATCAGGAT
CTCGATGTGATCCAGACAGCGATCCAGACATTGGTCGACAAGTTGAGACCTTTGGTCGACGTGATCGCGGACAGTCCGGACCCGAAGGTGCCAGATCTAG
TGTCGCCAGCTCCCGCGTCGTCGCCGCGGATGGAGTCCACTGGGTACCGATCGTCGTCTCCTTATGTCTCCGCAGCGGAATACGTATCGGATACGTCGTC
TGAACCTCAACGGATGTCCCTCGGCCCTTCAGGATCTGCGATGTTGGACGCACGATGACGGAGTCAACGTCAGGAACGCATGCGATCAGGACCTCGGAAG
CAGAAACCCAAGTCGACCGATCGGACCACCAGTACTACCGGATCAGATGAGTCGACTGGCAAACTGGAGTCTTCGCGGGACGTGGAGATGGAATCAGCCG
GATCGCCGGATCAAGATCTCTCTCAGTAGGAATACAATCCGGACGACATTGATCTACCGAGTTCAGCCCCTGCTGCGGTGGCCACCGCTGCCTCAGGATC
CACTGGGTCCTCATTGATCCAGCGTGGGCGGATTTCGGCGATGTCCGATCTTAAGGAGTTCAATGGCAAGGATCAGGACGAAGACCGCGGCCGATCGTGG
ATCAGCAAGGTAAAGTCGGCGTTCCTGCGAAATCAGACTACGGACGAAGAGAAGTGCCTGACCTTTGCTGATCTACTGACGGGCCCGGCGAAGAACTGGT
ACCACCAGCTGGGCCGATCGACGCGGATCAAGTGGAGCGATCTACTCCGGAGTTTCCAGATCCAGTATTGTGGCCTGGGAGTATCGGTCGCTTGGCAGTA
TTACCATTCTCGCAAGAGATCAGATGAATCGCCGTTGGAGTACCTCTATCGACTGAATGTGGCGGCTCTGCGTGCGAGATTGAAGATCAAGGACGGAGAT
TCCAAGGCCCGCCGAGAACATGTCGAACACTTTATCGAGACGCTGGGCGATCCGGAACTGGCCGATCGTACTCCGGCTTGCGGACGCAGAAGATCTGGAG
GAAGTCCTACGCGCTCGAGAGCGCGCGATGAGCAGACAGAAGCGATCCGCCTTTGGATCGAAGTATCGTCAGAAGGTTCCGACCTCAGCACCAGCTGCTG
CAACCAAGCGGGCAGTGCGTGCAGCGCAGATCGCGAGCCAGGAGTCTGGATCGGACACGGGATCAGACGGATCGGACTCGGAGGGTGATCTACGTCGCGT
TTACCTAGCGTCGACCGAGGACAAGTCCCGTAACGCTGGGGGCGACGCGACGAAGCCGGATCGAATCAACCAGGCGCAGATCAACCATGACCCACCTCGA
TCGGATCCACGATCGCGATCTTCACCTGACGGATCGGAGCGATCAAACCGCTGCTCACATTGTGGATCGCGGAAACACACCGATCTCGATTGTTGGAGAC
GTTTGACGTGCGAGAAGTGCGGCAAGAGAGGTCATCCGGCGGATCGCTGCCTGTTTGTGTGCCGTGGATGTGGTGAACTACACGAGATGGGCAAGTGTCC
GATGGAGGAATTCT