Description :
From Genome Similarity Track
Location :
contig_18:121918- 124926
Transcript NameFunction/comments
g3703.t1hypothetical protein

Sequence
3008 bases(100 bases per row)
AGATTACCGCTACGTGCACCTTAATGCGGACAACGCCGGCTACTGCAGCAACTTGGTCATCACGAGCCGCTTCACCGTGTACAACTTCCTGCCCAAGCTG
CTCTTCTACGAGTTCAGCAAGCTGGCCAACGCCTACTTCCTCGTCATCTCCGTCATGCAGACCATCAAGCCCATCTCCAACACGGGCGGCTTCCCGGCGT
CGCTGCCGGCGCTGTCCATTATCGTGCTCATCGACATGTTCTTCGCCTGTCTGGAGGACTACAAGCGCCACAAGGCGGACCATATCGCCAACAACTTGCC
ATGTCTACGCTTCCAGAAGGAGAGCAGGGCGTTCGAGTCCGCCAAGTGGCACATGCTGCAGGTCGGGGACGTGGTGAAAGTGGCGAACCGAGACCCGGTC
CCGGCGGACCTGGTGATTCTAGGAGCCTGTGAGCCCGAGCCGACGAACCCCGCGGGCATTTGCTACGTGGAGACGAAATCGTTGGACGGAGAGACCAATT
TGAAGCTGAGACAGGGACTGGAGGCCACGTACACGGCGCTGCTGAGTGACGCCGCGGTCGGAGACTTGAAGGGGACCGTCGTGTGCGAGACGCCCAACAA
CGCGATCCACCGCTTCAGCGGCTCCATGACGCTCGAGGGGGGCAAGAAGGAGGTCATCACGACAAACGCCATCGTGCTGCGCGGCTCGACGCTGCGCAAC
ACGGAGTACATCTATGGTCTCGTGGTGAACACGGGCCCGGACACGAAGATCATGATGGCCTCGTCGTCCGAGCCCATGAAGTGGAGCAACATGGAGAAGC
GCCTGAACAAGCAGATTCTGTACATTTGTATGCTCATGGTGGCGCTGTGCCTCACGGGCGCAATTTTGTCGACGGTCTGGAACGCTCAAAATCTGGACAA
GGACGCGCACAAGGCCGCGTGGTTTGTATGATGGCAACTCGACGGCCGTCAAGTCGCCCACGGGGAAGCTTTTTCATCAGGTGCTCTACTACTTTTGCTG
CTGAACTCGTTCATCCCGTGTCGCTGTACGTGAGTATGACGTCCGTGAAGTTCATGCAGTCGTATTTCATGAACAACGACCTGGAAATGTACCACGACGA
GACGGACACGCCGTGCCAAGTGCGCACGATGTCTCTGAACGAGGAGCTCGGTCAGATCGACTACATTTTCTCAGACAAAACGGGCACCCTGACGTGCAAC
ATTATGGAGTTCCGCAAGTGCTCCATCAATGGCGTCGCGTATGGCATGGGCGAGACGGAGGTGGGCATTGCAGCCAGGAAGCGACAGCAGGAAGAAGCAC
CGATGACGTCCTCGTTTTTTGCAGTAACTCCCGGTGGCGGCTGTGCGGTTCCGATGAGGAAAGACCGCATTGATACTGCGCCGGACTCGAACAATCCTCC
GACGGATCGTGTGGTCAAGGCTCCCTTCGTTAACTACCAGGACGATGCACTGTTCGAAGCGCTGGCGCAGAAGAACAGTGTCCAGAAGGGTCATTTTTTG
AGCATTTGGCAGTGTGCCACACAGTCATGCCGGAAAAGGCCCCGGACAACAGTCTGCGCTTGAGTGCGTCTTCTCCGGATGAGCAAGCGCTGGTCGCTGC
GGCTGCGTGCTTTGGCTACAAGTTTGTGGCTCGTGGACCTGGTAAGGCGATGGTCGAGTACTTTTCTTGCGTCGATCGCCCAGAAGAGATGACGTGCAAT
CAGCCGGTTGCTGATCACCCCGTTGGCGGCTACGAGATCCTGGAGGTACTCGAGTTTAACAGCACACGCAAGCGTATGTCGGTCATCCTCAAGGCCCCCC
ACGGCGAGTTGAAACTGTTCTGCAAGGGAGCGGACACCGTCATGTACGAGCGCTTGAGACCGACGAACGACCCTGCTGTCAAGCAGACGCGCAACCTGAC
GTTGCAGCACATGGAGCAATTTGCGTCGGAGGGTCTGCGAACGCTCGTGATTGGCATGACGGACATTGATCCGGCGTTCTTTGAGTCGTGGGTGATCCGC
TACCGCACAGCCATCAACGATATGCGTCAGATCGACCTGCGTCGCAATGGCGAGGACAATGACATTGATCGGCTGATGGAGGAAATTGAGGTGAATCTGG
ACATTTTAGGTGCGACTGCAATTGAGGACCGGCTGCAGGCAGAAGTCCCTGATACAATTTACAAACTGCGTCAGGCATCCATTAAGATCTGGATGCTTAC
TGGTGACAAGGAGGAGACAGCGATCAACATCGGCTTTGCTTGCCGTCTGCTCGCCTCGGACATCGAGCGGATTGTGATCTCGGCGGATACGCACCCGGAC
TTGGCTAGCATCATGGACGAGCTGGAAGCATACAACCGTGAGGATGACAATGAAGACACTTCGGCGTCGACAGCAGCTGGAGCGCTTGGTGTATCGGTTT
CGTCAGAGGCTCGACACTCGGTCTCGCTTCGGAACCAGCGCAAGCGAATGACCCGCATCGAGAGCATGGCGGAGATGCCAAAACAAGATTTGGGGCTGGT
GATTGATGGCGAAACACTGGAGCTTGCGCTGGAAGAGTGCCCTGAGCTACTACTGAAGGTGGCGGAGAAGTGCGTGGCAGTGATTGCTTGTCGTGTGTCT
CCTGCCCAGAAGGCTCAATTGGTGCGACTGGTTCGTGACAACAACCCTGAAATCCGAACTCTGGCCATCGGTGATGGTGCCAACGATGTCTCCATGATTC
AAGCCGCACACGTGGGTGTTGGTATATCTGGACAGGAAGGTATGCAGGCTGCGAACTCATCGGACTATGCCATCGCGCAGTTTGTCCCGACTGTTACTCG
TCCACGGACGATGGAACTACGTGCGCATGGGCAAGTTGATCCTGTACATTTTCTACAAGAATGTGATTCTGAACCTGACGCAGTTCTGGTACATGATCTA
CACGGGCTACTCGGGACAGAAGTTCTTCCTCGAATGGGGACTTCAGGGCTACAATCTGCTCTTCACAGCACTACCTATCGTACTCGTGAGCACCTTCGAA
CAGGATGT