Description :
From Genome Similarity Track
Location :
Scaffold_21:121914- 124323
Transcript NameFunction/comments
Phyca_LT15347638translation initiation factor IF-2, putative

Sequence
2409 bases(100 bases per row)
accgacgtggggatttccacctcctgtgccggcagctccaccctgggtttgcgcttagcctccttgcgttgcagtctctgggatcgacggcgttctcgat
cttccgagtcgctacgttcctcccagtcaatatctccaaacagatccgcttccgagtcaaagatgctgttctcaaactggaaattcttgagcaggttgcg
cgttcctttcttgcgtttcgtgttcatcttcatggccttacgaccgatgggtggtccttccatacggtcaccctctccatccgaagggatgcccagtgcc
gccagtacagtagacgggtccttatcccccgtgaaaagcttagtcttcttcggtttctgcctcgggtgcttgggttggcgcttggtaaatgccacgtcct
cgtcgtcattgaaatcttcgagtcccaactgagccaatgtgagctccggactctcctctttagcagctccgataccttccaacagatccagagacgtctc
ccggggttgaacagtcttgggttccgtcgatggagctaccactggagtttccacgtcttcaaaggcgaagctcagtaggttctggaacttgttcgtgaac
actggcggctcctggtcttctgccttcttaccacggcgctttctgttcttctggtgcttgttattgctgttatggttagatttcggctctgttttaactg
gtgcctctgtctgttgcgctcctttttgcggacggctcttgttgcccttaaactgaccacgcgcgcgcggttttggcgctgacaaaccgccgaatccacg
taaacccaacggaagaccagcatgtgcagtctccacgcctgatagcagcagcgcggaacggcgcagcagcttccattggctcgccatcactacctcaagc
ctatcggagctttatatccgctcagtgactggtgtgctacacactgctatttaacatcttgtaatgattgcaacagttaaatatcagatatgttaaaaag
aggtgatatcaatttcaaacaggttttcactcaacctgtctactttgatgatatcaactgtgaagagtcagttcacaagggtaccggtatactcaagtca
agttttcatacaggaagagcttgtcacgcgtggcggaagggctccatctgttggcgtctgtgaggctcggggggagatgctgagtgtgccgttggtgttg
ttccgaggcggagacaagatctgctgctctaaggaccgagtgaaactggactggctcgggcaattggttgtcggtctgggggctcatttcgcggcattgg
gggaactccagagactggcaatggagacttcagtattagatatcaaaggttcgaagcaggaaaagctgatggaacgcagtgggaatgaccaggaacgacc
tgccagcagtccgtgtccgtcctcgtccagtagtgacgaaagcagtagcagtgctagtagccccagttccgattcaagcgacagttcgaacaattccagt
gatagtgaagaggaagccccgccaccgcctgttaattccggcaatggaggtggaggcaatggaggagatgacgaaaagaagaaggagggagacggtaata
acagtgattccagcagtagcgacagctcagcagatgaaagtgaccaggaagaggacgacggagtgatgatcgatacggatgatgaaaaggacaaagtgaa
caatgggatcgacccaacggacgacgacttaagtgacgagagtggtggaagctccgatctggagaactcgtatccaagactaccttcagctccagtagac
acgctgattgcatttcgacagcaagcagcactgaaggagttgcagatgacggagaagctcaagaaggaggttatagaagatgctaagcaacgactccaag
gccgacagcagtctcagcgctcgaagaagaagaccccgcagtcgaagcgacgacagtcaaagcagagtgacagaatgtccaacggcacgcaccttgagag
gcaccacacgaacggcagcaccggaactgccgatatgaaggaaggtgctgaagatgagtggctggtggattgctcctgtggactgaaagagaaaaactat
gatgatggaacgtcgatgatccagtgcgatagctgctcgcactgggttcatgcgaaatgtgccgacaaacaacccgaagctgtggcccaggagaagtttt
tgtgcttccaatgcagctggatgttcgattgtgtgtgtgatgttcgccaacgacccaaccacgacgatggtcagcggatggtagagtgtgagagctgcaa
aacatggcagcacacaatgtgtgtggggatccccatgaccgaggagccagcggatgattaccagtgtccccgatgtgttcggaaagctcgtcggcgtaaa
tccgcatcg