Description :
From Genome Similarity Track
Location :
Scaffold_1915:1219- 3480
Sequence
2261 bases(100 bases per row)
GAGATACTTGCGCTCCTGCGCGTGTTGGATCTAAATTATAACCTGCTAGTGGGAAGATTCATCCGGATTCTGACTCCGACACTCCACGCTAGCCTGGCTG
TTCAGTCGGCCGATTGCAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGACACTGGAGATGTGAAATGTTCAAAAGGGGAAGACGAGATCCT
GGGAGTCTTGCCGCGAGCACCACTCCTCGAGCTAACGTGGATGAGGCGCTGACTAGGATCGCTTCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGA
TCCCGACGGTACAGGATCTGTACGTCCTGAGTTTTCGATGGATCCGCTCGCGTACGACGCGGAGGAGGGACATACAGCGCAATACTGTGGAAACTGCCCG
GATGGGAAGTTGTACGGGCCAGATCCACTTACGCGGAAGGCCTCACCGTCAATGAAGCGGAGTATAACGGACTCCTTCTGGGTTTGGATTTACTAAAGGG
ACAATATCCAAAACGGCTGGTGATTTGTGGGGATTCAAATTTGGTAATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTA
CGGCAGAAAGTGATGATCCACCTGCGTGGTTGGTTGAATCACGAGTTGGTACATGTCAAGCGAGATTGGAATGCCAGTGCGGATAGTTTGGCCAGTGCCG
CTTTACGGAATCAATGTGGTGTCGAAGTGGAGGGAGAAGCCGAACATCAGGATCTCGTTACGTTGAACCGACTTGACGAAGTGGTAGTGGTTGGATCCGG
GAAAAGGACAGTCCAGGTGATGGCTGTCACTAGGTCCAGAGGAAGGATTGGATCCAGCCCCCCGATCCTCGAGGAAACATTCGTGAAGAGAGTTCGCATC
GAGCGGATCCTCAAAGCACAGAATGAGGAAGCGTGGATCCTGGGACTAAAGAAGTATCTGATGGGGGATGTACGAGAATTAAGTCGGGAGGATGCCAAAT
CCTACAGCGTTATCGCTACGGATTACGCAGTGGATCTGAACGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCCACGAGGATCGGTCGGAGGAGTT
TGGTCGAGTCGTTGGGGTGTCTGCGACAGCGGAACCTTGGACGGATCTTCATCTTGAATCATCGGTCGACTCACAGGCTGCATTCCGGCATTGATGCCAA
CAGCGCCAAACGCCTTCCGAAGATTCTTCTTCCATTTCTGGAGAGAAGCTCCGGCTTCATGTGGACTCCAATCCTGGAGCGACATCGTCGATGGGTACGT
CTCGTTCTCGAATCCCAGCGACAACAGTAGCGAAACTGAACCCTCGGCAACTTGGCTAGTCGAAACCGAGTTGACTGGGTATTGAAGTTCCTGCGCAAGC
GCATGCCAATCGGCCTTTTTCTTGGGGATGGGTTTGAGCAGCTGCATCCACTCATCATTCTGCATCAGCGTTTGTACGCGGTCGAAAACGCGTTTGGCGG
CTGGTGTATCACCGTTGATAGGTGGGCGAGGTGCCTTCAGCAGTGCTGAATGCTTTGCACTCGCCACCGAAGGTTTAGAACCCTGGGTCCCATCGTCATA
ATCTTCGTAGGCCGGTTCCGGTCCCGCAACATCATCGAGCTCGTCGGCGAGGTTCCTCGAAAGGGACCTGGTCGCCCCGCTGAGCCCCGATGATAGCGTG
GCCGTCTCTGGCGTCGCTGCGCCTGGCTCTGGAGCCGGCGTCTTGTCTTCGTAATCTTCATAATCGTGGGCGTCAGGACCGATGTCCGCTTCGTCGTCGA
AGCTCACTGAAAGCTCGGTGGCGGCTGCAAAGCGCTCAGCCGGGCTTGAACTCTCGTTGCGAGCCCCGCCAGACTTGGCAGGCGTAACTGGTACCGTCGG
TTGTCCTTTCGCCATGTTTCTTGTTCTCTTTTTCTTCTTGTTCTTCTTCTCTTCGTAGCTCGTAAACTGGAAGGCCATACAAACAGCTCACAATGGTCAC
AATCTGTTCCCGGGTCGCGGCACCAGTTGTGGTGTTGGAATTCCCACGTGAACTCTAGCTACAAATATAGTTAGGACGTTCCCACAACAATACGTCTACT
AGGATAGTTAGAGCACCAGCCGTGGCTTCACATTCGGTGCAAAGACGATGCAAAGCAAATCAAGTTTGAGCAGCCGCCTAATGTCATCAAGGTGGACTGG
ATCAACTACGTTCTGCAGACCGGAGCGGGAAGCAACGCCTCCGCCACCAACGGGGAAGAGC