Description :
From Genome Similarity Track
Location :
scaffold_48:121849- 131530
Transcript NameFunction/comments
g7447.t1 hypothetical protein PHYSODRAFT_359933
g7448.t1 conserved hypothetical protein
g7449.t1 hypothetical protein PHYSODRAFT_491245
g7450.t1 hypothetical protein PHYSODRAFT_543861

Sequence
9681 bases(100 bases per row)
ACGCCTTGGCGGTCGCAATCACTTCTGCTTAGACTCATCTTCCTGGCTATCGGGTTTTTCCTCCTTCTCGTCACCCTCCGCTTCTTCGTCCTCGTCCAGC
TCCACTTCTTCATCCTTGGCTGCCTCAGCCTCATTCAGCGGTGCATCGTCGCCCTTTTGCTCGAGAGCAGCGAGCTCCTCCGCACGCATGGGCGGCGCAA
TGAACCACGGCAGCTTTCCGCGCTGGTAGTCGTTGATCATTTGCACGGCCACATTGTTGTAATCGGGCTCTCCCTTCTGCAGAAGCTTACCGCACTTGTT
GGCAAGCTTCTCGAGGAAATCCCATTCATCCTTCCACTCCTCAATGCCGTACACCTTAATGAGGAACTCCTTCTTGACTCGCTGGAGAATGGTCAAAATG
AAGTCCGTCGGCTGAGGCAGACGCTCAGCACGAACGACACCCTTGAGCACCGTCTCAATCTCGTCATCACCCGTGTCGTACACGATGCCAGGGCAATCGA
TCAAGAAGATGCGACGCATGAGCGTAATGTACTGCCACACCTTGGTCTCACCCGGGATCGGGGCCACCTTGCACACCTTCTTCTTACGTAGTGCGTTAAT
AACCGAGCTCTTACCCACGTTCGGGTACCCAATAAGACCCACTGAGATCTGCTTTTTGTCCTGGTGCAGCTTGGCAAACTGACGCAGTAGGTTGATCAAC
GCACCCTTGCCGAACGGGTTGCTCATGGACGCGTGGAAAGCCAGCGTAGGCGTCGTCTCGCTGAGCTTCTGCACCCAACGCTTGGTAACCCAGTTGGGCA
CCAGGTCACACTTGTTAATGACAAAGATCAAGTGCTTGTGTGACGCGTTCTTGCGGATGTGGTTCTCCACGTGAGAACAACGTGTACCAGGCACGTTGCG
TGCGTCCAGAACCTGAATAACAACGTCGGAACAGTCCAGCACCTTGTAGAGCTCACCCCAAATGCGCTTGGACTGGCCCTTGTTGAACACGTCGTGCGAG
ACCTCCACCTTGAAATCCTGCTCCACCACAATGTTGCGATCGGGTCCCTTGGCCTCGTACTTTTCGGCGTTCTCTTGGGCCTTAGACAGCAGCGCCGCGT
AGTCCGTGGCTGCGACTTTAGCGCGCTTGCGGCTGCGCTTGCCGTTGAAGACCTCGTCGTAACTCTCGGTCTCCAGCAACTTCATGCGGCTCGTCTTCTC
GCTCTCCTGCAGCAGACCCATGGGCAGCTTGCGCGTGCGCAACACCACCGAGTAAGGGTCGGCAGCCTTGAGCGACATCTCGTTGCGGAACTTGTCCAGC
TCCTTCTGACCCACGACCCGCGTGTTGCCAAACCAGCGACGGTCCGGCTGCACGCGTCCGCTGGCACTCGTGATCTCCTGGCCGCCGACCTTGTTCTTCA
TCATGAGGGTGCCGCCGACGACCTTGCCGGCCTTGTTGCGGATGGCACCGCTGTTACGGTACATGTTGAGGCGCTTGATGGTGCTCTTGTCGCGCATGTT
GGCCGCCTTCTGCCGCTTGGGCATCTTGCGGTTGGGGTTGTCGGCCGACGCCTTGGTCGTGTTGAGGCCCTTCGCCATGGCTGCTGCGGTGTTCGACTAC
GGAGTTCGAGAACCGGGAGCGATTCCTCGGGCAGCGCAAATATCGGACAAGTACGCTACGGAGCTCTTCGCAGTCCGTTGGATCGATTGGTTGGACGCGT
CGACGCGCATTTTCATCCACTAAAAAGAAGTCAAGTAGATTTTCAGCCAATCCTCGATGAGATGTCCAAATATTAGACACAACCTGACTGTTCTTTCACA
AATTACAAATGTAGAACATGTACCGGATCAGGTCGCATGTCAGGTTTCATTCTTGAGCAGACGTGAGCCATGGCGACGATGGCGCTCGCGGTACAGCAGC
AGCAGCAGCGCGCGGAGATGGCGTCGTACCTGTACGAGAAGCACCTGACACACCAGGACGGTGTGGCCGGCACGCTGAGCATCCGCCTTGTGGCCGCGCG
CAACCTGCGTGCCGCCGCCTCCATGTTCTGGGTGCGCACATGCAACCCGTACGTGATCTTCCGCGTGGGCAAACAGAGTGTGCGCAGCTCCACGATCCCT
GGCAACGACAACCCGACGTGGCGCCGCGAGTTCCTCGAGGTGAAGCTGCCCAAGTTGCCCCTAAAGCGCCAACCGCTGGGCGAGCACTCGGACGTGCGGC
TGGAGCTCATCGTGGACGCCATGAACGAGGACTCGCTCACGGGAAAAGCCACGGAGGCTGTGGGCATGGCCAGCGGCTCGGTCATCGGCACGGCGTCCGT
GGACTTGACGCCCCTCGTGGAGGGCAAGGAGGACGTCTTAGACCAGTGGGTCCCACTCAGCGGAGCGCTGCCAATGCCTGGCGCAGGTGGCGCAACGACA
GGCAAGAAACAGCAGCCGGAAGCTGATCTCAGCCTGGGGGAAGTGCGTATGGTGCTACAATACGAGCCGCACGGAATGGAGCCTCGAGTGGGCGACGTTG
TCAAGTTCGAGGGCTTTGGCTCGTACCCGTCCGCGGTGCTCGGCCCCGTGGAGGATTTGGAGCTCCATGTGAAGCGGACGAGCGGCAGCTATCTACTGTG
CAGCTACACGACCCCGTCGGGCTACGATGCGGCGCTGCGAGTGCACCGCAACAACGTGTTTGTGGTGCATCGCGGCAGTCTTTTTGACCGCTTCTACGAG
TCGTGCATCGTCGAGCCGCTCGAGTTCGTGGGCAGCACCCCCATCGGCCAGTCGGCCAAGGAAGTGCTGCGTCCGTATATGAACGTGGCCCGCGCTTTCA
GTGGCCCAGCGCTGATTGCAACGAAGGCCACGCTCATGACGACGTACCGCGCCTCTACAGCTGCAATTGGCGCTGTGGTGGCTTCGCTGGACGAGTAAGA
GACGGCAGTGAGCTGGGAAAGCGTGTAGGTATGAGGCTGGAGCCTTGCAGGCGTAGCACAGTTAGGAGTCAGTGGTAAGTATGAGCCTGCTTTTATTAAT
AGGAGGACAATCTGGAGGACAATATGTGCATCATGATTGGCAGATGTAGCCATCTCAGACTTGAAGACACCTCGCCAAGGACGTCGACAAGGTCTCTGGG
GCTCTGGGACAATGCAAGTGCCTGCCACCGCTTCTCCACATACGAATCGGAGCCGCATCAGCGTTGATGGCGTCATCTCGCGAGAGTCTGGACGACTTCC
GGTCACCCTCAGACACGAAGAGCTACCGACTGCTCACTCTGGGCAACGGACTGGAAGTTGTGCTCGTCCAGAGCGATGCAGGACGAAGTTCTCGAGTAGA
TGCCACTAGCAACGACGATGACATAGCCCGGGGCAGTCTCAGCTCAACTGACGACACAGATGCTGACAGTGGAGACGAAGGGAAGGAAGAAAACGACCAA
GAAGAGACCAACGATCGAGCTCCACCACAGGCAGCGGCGTGTTTAGCTGTGAATGTGGGCAGTCTAGCAGATCCGGAAGCGCTGCCGGGTCTAGCGCACT
ATCTCGAGCACATGGTCTTCATGGGCAGTAACAAGTATCCCACTGAAGACGCGTTTGAAGCTTTCCTTAGTGCTCACGGCGGCTCCAGCAATGGAGCGAC
CGAGTGCGAGTCGACACGGTTTGTCTTCGATGTGGACGCTGGCTACCTCGAGCCGGCGCTGGAAATGTTTGCGAGTCTGTTTCTAGCTCCGTTGCTTCGA
CGAGAAGCGATGGATCGAGAGCTGAAAGCGGTGGAATCTGAGTTCCAACGTGTCCGAAACAATAATCCGGTTCGTGTGCAGCAGGTCATGTGTGAGACGA
GTGTCCAAGGACATCCGTACTCTCGCTGTTTTACGTGGGGAAATGTGGAGAGCTTAAAGTACAGTCCAGAGCGTGATGGTGTTGACGTTCGTGAGCAAAT
GGTGGAATTTTTCAGCAAGCACTACGTAGCGCCGGCCATGAAGCTTTGTGTTTATGGATGTGAACCTCTTGATGTACTGGAGCAGTATGTGACCCAAAGC
TTTAGCGCTATCCCACACAGCCGTAACAACTACGAAGCATCAAAGCATGAGCAGCTACCGGAGCCGTACGGATGTGGAGCAGGCCAGCGACCAAGCATTT
TACGCGTCATTCCTGTAGGTGAGAAGCGCTCTATGCGCTTGTACTGGATGCTCCCAGCGATGATGGAGAAGTATCGGCAGAAGCCTTGGTATTACGTAGG
TCACTTGTTGGGTCACGAAGGCCCAGACTCAACAGCATCGGTTCTCAAGCGCCGAAAGTGGGCTACCGACCTTATCGCTGGGACGTCGGATCGAGATGCT
TACGAATTTGGTTCCTTCGGCACTGTGTTCGAGGTTCGAGTAGCTCTCACGAAAGAAGGTCTGGCCTGTTGGGAACAGGTTGTGCAGCTTGTATTTGATG
CTCTGCAACTCTTCTCTGCTAAGGCAGCAGAGGATGGTTTGCCCGATTGGCCTTATGAGGAGCTCCGCTCGTCCAGTGAAATGGATTTTCGATTCCAGGA
AGATGCCAAAGCACCAGTGTCACTTTGTCGCGAGCTTAGTGAGCGAATGCTTCCACGTCACCATGTACTGCAAATGTGCCAAGGAGATCTACTGCGTTAC
GATCTGATTCAGGGTGAATTCGACAATTCGTCCGTGTCTGCCTTCCTGGCTGGGCTTTCTGCTGATAACGTTCGTGTCGTTCTGTTGGCGTCCTCATTTG
GTGGCGATTTCAACTCGGAAGAACTCCGGACTGAACGATGGTTTGGCACCAAGTACACCGTGAATCGAATACCTGATGTTGTGCTTGCTGCTTGGTCGCA
GAGCTCGGGGGAATTTGCAGGGGTTTCGCCATTGCCAGCACCTAATCCTTTTATGCCTCGGGACTTCTCAGTGCTGCCTTGTGAACCGGCCACTCAAAAT
GACAGCAACATCCCTCCAGACCTCATTCTCACCACTACAGCAGCGCAACTTTGGTACAAGCGTGATCGCACCTTCTTGGTTCCCAAAGCCAGCGTGAGCT
TTTTCGTGACACTTCCCGCTTCAACTGCAGTGAATTACATGCTTGCTGAGCTGCATGTCGAAGTAGTCCGCCATCGATTACAGCACACACTGGAGCAAGC
TGGCGCTGCAAGCTTTGACGTTGAGTTGGATGTTCGAGACGAGGCTATAGAGGTTGTGATTTCAGGTTTCAGCGACTCATTGCCAGCGCTCGTTCGATCC
ATCATGCAAGAGGTTTTGAGTCCACCAATAGCGTCCGAGGTTGTATCGGAGTTGACACTTGCTCGGATTGAGCTTGAGCGAGAGTACCGCAATGCAACGC
TATCTCCTCGAGAGAAAGCGTATGAATTACGTCTTCAAATGCTTGAAAGCAGAGCCGTTTCCACGGATGACAAGTTGGAGGCACTTCAAAGCAAGTATGG
TCGTGAAAAAGAGCTTGCAGCTGACCTCGCACATTTCACGGCCACTATTCTCGGGCGAAACGAAGGTGTTCCAGCGACACGATGCCTAGTGATCGGGAAC
ATGAGTCGAGATGCTGCCATAACACTGGTGCTAGACGTTGAAGCCGTCATGGCTGGAAATACTGTTTCTCCTCTGGCTTACGAACCGGACTTGGAGCTTG
AACCTGAACCTCCCCTTTTGGTTCCACGTTGCCACACGATCGCTCTGCCGTCTACGACGAATGGTTTGCTTTTGCGTCGTCAAAGTGAGCGAGTCGGCGA
GCGCAATTCAGTGGTAGAGGTGTATTTCCAGATCGGCAAAGTCGGACCGGAAGACCGAGCGTACACTCTCCTACTGCGCGCTCTACTAGCACAGCCACTC
TTTCACGAGTTACGAACAAGACAACAACTGGGATACACGGTGGCTTGCAGTGTACGTGACACGCATGGCGTGCTCGGGTTGAGTGTGAGCGTGCAGTCAG
CCTCCCATGCTGCTGGTGCGGTGGCGACCAAGCTTGATACCTTTCTTCACGAAGATTTTCCTCACGATTATCTACTCTCGGAAAAACGACTATCGCCCAA
ACAGTTCTCAGCACATGTGCAGACTCTGCAGCGGACATACGCGCGACCAGACTCAACACTGGCAGAGCAAAGCGAGCGCTTCTGGGAAGAGATTGTTAGT
GGTCGTCTGGAGTTCGACTTGGATGTTCAAATAGCGAACGCCTTAGGAGGCTGTACACGCCAAGGTCTGCTCGCCCGGTACCAGTGCTGGTTGCAGGGAA
GTACAAGCTGTTGCAGTGCCTGCACGGATAACCCTCACGTTGGCCGGAAGGCCCTGCATAGATCAAGCAAAAGTCACGGCCCAAGGAAACTTCGGGTGCA
TGTTGTGGGCAAATGCAGCCCGTTTAAGCCGATTGAGCAACTTGTGCCGCCTGACAAGACCCCAGTGATCATTTCAGGCGACTTGCACGATTTCAAGCGC
GAGCTGCAGTGCCACTGCCACATTGAAAATGCTAATACTTAGAGGAGGGAGACAAAGAGAGGAATCTATTGGGACTGTTTTGTCGCCTAATGCAATTGAG
TTGCCTGGCACACGGATATCTACATACGATACATGGGTCTAGCACCCGTGTGCCTATCAACCTTCACCTTGCTCCTCATTTGTCTTTTGGTACTCGTGTA
ACTCCGACGGTGTCACGAAGTTGTGTATGGATGGCCGATGCATAGCTATAATGGTTCGACGAAGTCGTGGCGACGACGCGCTACCCGCAGCTGAACCATC
GTCGCTTGATTTCGACTCTCGCTGAAGTAGATTTCGTGTAGAACCCCGCGTCATCGACATTTCGCGTAATGCATCAGATACTACAAGACGCTTTTCTAGG
TTTAGTACCCGACTCTCGATACTCTCAGACTGTGTTTGCATGCGAACCTTCATGGCTTCCACCTCATCCGACACACGAGAAACTTGCTCCAGAAGACTCT
GAAGTGTCAATTCCAGTACCAATGCCCACGTTGGAACATTTTCCGGCGGTGCGGTTTGAGCGAAACTCGGACTGATGCTGGTGACTTCGTTGGTTAAGGA
ATGGCTAGTGCCACTTCGGTCACTTTCTTGTAAGGTGGCCATCGTTGGGGCCTGTTGCCGAACCTGATACGATTGCAGCTGAGGGCGTAGAGGTGGCCGC
TGCAATTGATTAGGCTGCTGCTGCAGCTGTTGCAAGAGGGTAATGGAGCCACTGCTGGGTGGTAGTGAAAGTGAGCCCCCTCCATTAACTGGTGTAGATT
CAGTCGGCGGCCCCGAGATAGAAGCGGCAGCCATGATGCTGCTTAGCTTATGCGTACGATCTGCAGTTTGGGTCAGAAAGAGCTCCGAAAGCTCTTCAAT
CTTGGTGCGAATGTACTCGACATTGACTTCCATCATCTCTAACATGGTCATCTGCGAATCCATGGGGTCGCTAACATCGTGTGAATGAACTCGCCGCTTC
ACTTGTCGATATTTGCCCAGTACCGTGAACAATTTGAGTTCTGCACGACGCAGAGCTCGCTTGGTGCTGCTGGTACCTGCTTTGCCGGTACTTTCGGCAG
GAGCCTCGCTTACTGAGCCATTTTCGCCTCCATCTGCTCTGGATGAAGGACTTTGGGTATGCCGGCGTTGTGCTGCTCGTAGTTGCACGAAAGCCTGAAG
TGCTCGAGCGGCATGGTCACTTATAATCCGGCGATTTTCGTCTTTCTTCAGGAAGGCATTGACCTTGTGTTCTGAGCGCGTGAGCACGAGGTAGTTGCTC
ATAACTGCGATAGTGACAGCAGTTGAGAGGGTGCCGAATATTCCAGCACTTACTGCAATTGCACGGCCGAGAGTCGTGCGGGGTACAACATCGCCGTACC
CGATAGTGAGAATGGTGATGATTAGCATCCAAAGTGCATCACGTAGCAGCATGGGCTCGCAGCACGAACCCTCTTTGAACGCGCACAAAAATCGCTCGGA
CACGTACAATGCGTACCCCGCTACAAACCCAAGAGTAGCGAAGCTTGCCATCAAACAACTCGTGGGGTGGTTCTTTAACGTCGATTTCATGAAGAACTTT
GAGGTGAAGTCAACATTGGTGAGCGCCCCAATAAACCATCCGTTGCTCGAATTGAACGAGTTGCGGAACTGCACCACCCGCACCACGAGAGCCACGCGCG
CGAACATGAACAGGCTTGTGGCCACAATAAGCTGTGGCCATTTCGGATCCACGGACTCGATCCCTGGAAACGGGTGAATACCTAGTACGGCCATCTCAAT
CAGCAGCGTACGCCGCAATGAAGAGCTCATGAGTGTAGCCTTGGGTGGCACGATGTTCTTGAGCTTCATGACCTCGCACTCGGCAGCGTAATAAAGATAG
ATGTAGTAAAGCATGAGAGCAGTCGAGAACGTAATAAGGATGCGTAGCGCCAAGAGGACCATGCGGCCTTCGCTCACCGGGACAGACGTACCGAGGGCCT
CGAAACAGAGCGGACACTGCGTAGTCGACTCCATCGGACACGTGCTAGGCAAAGTCTGTGTGTTGATGAACCACAAATACTCCATCTGCACCATCATGAG
TACGACCCCGAAACCCCCAAAGAAGAGCTGGAAGGAAGTGTGTTGTCGCTGCGAGCGTACCAGCATCATGCGCTGCTCCTGCAAAGATACCATTTCTGCA
CTTGTAGCTTTGACCTTGCTGCCAAAGGCATTTGCTTTGGGTTTCTGATGTACCGGGACAGTCACTGCGTCTGGGCCGGGGCGACTGTCAGCTTCAGAGG
GGTCTGCGTTGGCAATGGCGACATCAAGCGGCACAATTTCGTTCCTGTTCGGCATGGTCGCAGGGTAGGTATGACACGCACGGACTCAGTTGAAAATGAA
AATACCGGAGATCGGCGACGCACGAGACGACGACCAGGACACGCGGGCATTCACTCGCGCTCGGCTGGAGTTGATTGCCCAGGGTGCAGCAGCAGTTTCT
AGCCCTTCCTCCAAGTTGTTTCTCGTCACTTAACGTAGTGGCGGACACCATGCGCCGCAGTTGTGGTATAAATAGAGCGCGAGGGCGAGGGCAGTTTCTC
TTTTGAACAATGTGGTGTGCATACTGGAAGAAAAAAAAAAGTGGGCGACTTGGCTCTTGACAATCGACATCAACAACATTGGGGCACCAGGACGTAACGC
AAAGAAGCTGCTTTAACGTAGCCGAGTCTCTACGTGGTTAATCCACTCAAATCCTCTCCTTCCCCCCCGTGCACGACGCGAGCGTCGCACAGATTGGCTC
GAGTCCTGGGTCCGACTAGAAACTTAGTAGAAGAAGCCGATGATCTTGCCACCCGTGTGTTTGCGGCGGGCCTCGTGGTGGTCCATGATGCCGTACGTGG
TGCTCACGACGATGTGGCCGAACTGGCGCGAGGGCAGCAGGTTGTTGATCCACTTCTCGTAGTCCGCCATCTTGACGTCGAAGCGGGGCGAGATGACGCC
ACACTTGTTGATACGGCCCTTGAGCTCCACGACGATCTTGCCGGCGCGGTGGTCGTCCACGATCTCGAACTCGCCGATGTAGCCGTTCTTCTGCATGACC
TGCAGGAACTTGACGATCACCTTGGAGCTCGGGCGGATGAGCACCTGGCGCTTGCCGCGCTTCTCGGCGTTGTAAATGGTCTTGAGGCAGTCAGCCAGCA
CGCTCATACGAACCATGGCTATAGTGGAGAAAAGACAAACACCGTTAATCCCTACTGCTAAGAGCCAAGGTCAGCCGCCGC