Description :
From Genome Similarity Track
Location :
Scaffold_15:121846- 129046
Transcript NameFunction/comments
Phyta_totarag982hypothetical protein
Phyta_totarag983hypothetical protein PHYSODRAFT_489802

Sequence
7200 bases(100 bases per row)
ACATCAAGAGCACTTCATGGCGTCCAAGGTTCTGCAGGGAGACCCGCGCCGTCCAGGCGACTTGCACCCGTTTGTGCGTGAGCAGGTGGACCCCGACGAT
GCCCCGGGCGACTGGtacgccttcttctcgctcgtACTGGGCTTCCTCGCCTTCACCATGAAAGTACGTCCCGTCAAAATGCATAATATTATTTTCTATA
TTCTATTCGTAgataataataataatttGTTATTTTCGTGTGTATCCTTAGTGGAAGGGGTTGGCCTGGggctcgctgctgctttgcgTGGGCTCGTTCA
CCAACATGAAGTCGCAGGATATGAACACGACGCAGGTGGCCAtgtctttcttcttctccacaagcGCCCTCGTGTCCGCCTACATGGGCGCCATGCGTCC
CGGAATGCCCATGCCCCCATCTGCCCACACGGTCGAAGCCCCCACTTCGTAGACAAGAGAAACATATAGGGAGAGTGTATCCAGCAGGTCCAGAGGTGGC
ATGCTGTAAGAATGGAAGAACGCCGAGCTGTTGGTACTGTGCTTTGATCTGTGGAGTAGGAAGTTCTTGACTATAGTAACTGGACGTGTGGAGTGTTGAA
GGTAACGACGGCTAGTGGGTGGTGCCTATTTAGGTCTAACGCTGATTGTAAAATAGGTCCTGTAATTGCTGCCAGATAATGACGATTGGGCCCCATGAAG
CTTACCCTGAGAGttttggagaagaagcagcacggacGAAGGAGGCACATCGTGGAGATGGTGACGGCTACCACAATGCAAAGCATGAGGCTGGTGGGGT
GTTACCCCAGAAGCTGATGAAGCGGCCGCGAGGGCTGCCACCTGCCAAGATACTTGCGACGTCGACTGCACCAATGACATGGGTCTTACCACCTATTAGG
CCAGCAAGTCCTGGCAGCCACGCTGCACCTTCGACTATGACTCTGGAAGaaaagcagcaacgacagaTGCACTCGTTCCTGCGTAACTTTCTCGCTGCGG
GTGAAAGCGGATGCTTCCAGCAAGTGATTGACCTCCATCAGCATGGAATTGACACGGGGATCACTGTTACAGACGCGACATTGCAAGAAGTAGTGCTCAC
GGTGCCGAGCCTGCGTGGATTAAACCTCTCGGGCTGCTCGCACATCACTGATGCCGGGCTTTGGGCCGTGGCCCGGCACTGCCAGACACAGTTGGACACC
ATCTATCTAGCCCAGTGCGAGAAGGTGACAGAGCTTGGGTTGCGTCTGCTCGCTCATAATTGCAGGCTTGTACTTGTAGATCTCAGCGACTGCCCACAGC
TTAATGACGCCGCGTTGCAGACGCtagctgctggctgctggatGATCGAGACCTTCATAATGAAGCGGTGTCGAGGAGTCTCCGATGCTGGCATCGTCAA
AATCGCCCAATGCTGCAAAGACTTACGCCACCTGGATGTTTCGGAGTGCTCTCGGCTTGGCGAGTACGGTGACAAAGCGCTACTTGAAATCGGAAAATGT
TGCCCGAAGTTACGCGTGCTAGATCTCTTTGGTTGTCAACACGTGCACGATCCGGGTGTTCGCGCCGTCGCGAAAGGCTGTCCATTATTGACCACACTCA
GGCTTACTGGGTGCCGAGACGTCAGTAGTGTCGCTATTCGTGCACTGGCTCAGCAATGCACACTGCTCGAGGTCCTATCACTTTCTGGTTGCATCAAGAC
GACGAATAGTGACCTTGAACTACTAGCTACCAACTGCCCGCAACTCACCTGGCTTGATATCAGTGGTAGCCCGAATATCGACGCTCGTGGTGTACGTGCA
CTAGCACAGAACTGCACTTCCCTGGCATATTTGAGTTTGGCGGGATGTCAGCGTGTAGGGGATGCTGCAGTGAGCGAACTTACGAGCGCAGGGGCTGGAG
GACTCACAAAGTCTTTGGGGGAGCTATCTCTGGCAGATTGCCCTCGAGTCACGGAAAACGGGGTCGACGCGCTTACAACTGTCTGCACCAACCTTATCAC
TCTTAATCTCACTAATTGCAAGCAGATTGGCAGAAGGTTTCTCCAGAGACTCATTACAAAGCTCGTATTCGTGCAATGGgccacgagcttcttcgggtAC
GAGCCGCTACCGAACGCCGCCGAGCTGTGCCGTCAACGCGATCACCGTTTGTTACAACTACGAAGCGCGGTCAAAATTCAGTCAGCAATACGCGGGTGCC
TTGCTCGTGGCGGACTATGGCAGTCAAAGCTCAAGTTCGTGGAGCGAAGAGTATTGCCGAAGATTCAAGCGCGTGTGCGTGGGTTCTTGGCGCGAAAGCG
CCTTGCTGCAGAGAAGCGATGCCAGCATGAAGACCATGCTGCGCGATTAATTGGGCGTGCGTATCGCGACTTGCAGCTTCGGCGGATGTTGGTACGCGCG
AAGCGGATACGTCAAATCAAGGaacacgaagatgaagctgccCTCATTTTCCAAAAGATTTTCCGTGGCTATCGTGACCGCAAGTTTGTAGCGAAGATGC
GATACGACATCTATTGCGAACATCAGCTCCAAACTCGCGTGTTAGTCATGCAGAATTTGGCAGCTACGAAATTGCAACGTGCATACCGAGGGCATCGTGG
ACGGTCTGATGCTACTATGCTGCGCTCAATCAAGGAGGCAAAGCATCTTCAGCATGAACGAGAGGTTCGTTCAGCAGCGTTTTTGCAGCGCGTGTATCGA
GGTCACAACGGACGCAAAGTCCGTGCTCAACGGGTTGCGGAGTTGCTTCACCTGCAACAATGTCACCAAGGCGCCATCGAGATGCAAAAAGTGTTCCGTG
GTCACCGAGCGCGACGGCATGCAGTTGTTCTGCGTACAGAGGCAAACGAACTACGGATACTTAACGCTGCTCTAACGATTCAAAGGTACTGGCGCGGTAT
TCGCGACAAGCATTTGGCCGCTGTGCTGATTGGGTTAATCAAACTACGTGCCCGAGAAAATGACGCTGCACACTCGATCCAGGCTGCTTATCGTATGCAT
GCCTCCCGGGGATTCTTGAAAACGATGAAGCTGGCTTTGGCAGCTCAGTCAAGACGGGTGAATGCAGCGACAGATATTCAACGTCTAATACGAGGGCACC
GTGGGCGGGCTGAGGCAGAGCTTCGGAGGGAGTTGCAGCGGTTCCGTCTCCAAGCCAAGCCTTTGTTTGCGAAAGAAGCGCGTTTGCAGGCGCTTGTGGA
CGACTTGAACGATAAAGTGGCGCAGCTACAACGAAAAATCGCtgccgatgaagaagaagagcgtgcgTTGACGTTGGAACTCGAGAAAACGCTTCAGATT
AAAACGAAGTACCACGACTCGAGCCGTATCACCGGGACGCCTCAACGCTACCTGACGCAGTACCTCCAAGTTCAGCTTGCGGACCAGCTACGAGCAAAGC
GAACAGAGATCGCACTTGATGGACGGGCATTCGAAACACTCTCGACAAATTTAAATGACACACTAAAGCAACTTCGAGGCGCTAGGCGAGCACTCGAACC
GCTAACCGAGGGCGTCATCAAGAAAACGTACGAAAATCGAGTGAAGAGGCTACAGGATAAGGTTCGTCACGAGCGCTGGGCGGCAATCACCATTCAGAAG
ATATTCCGTGGCTTCCGCGTAAGGGCAGCCGTCCGTGAGGGTGGAAATTGCTGGATTCAACTGGTTTCACCCGACGATGCTCGCCCTTATTTCTACAATG
CACTGACAGGTGCTACGCGATGGCGCCGACCATTAGCGATGGACATATTCGGAGACCATTTTGCAGAACCCATGAACGAGTCTGTCGACAAGCCTGCTTC
ACCGGAACAGAGCGTTGTACAGTCCGATGGACAACGTGTCAAGAGCGGTGAACAAGCACCCGCCCCAAGCAATTGGTACGAAGCCTTCGATGACAAGATT
CAAGCCTCGTACTACTTCAACAGCCAAACCAAAGAATACCAGTGGGACAAACCTGATGCTATCGATAATGCGTACTTCACCGACAGTCAAACGTCTCGAA
AGCGGCGGGAGTGGCTCGATGAACAGCAGCTAGACCTTGAGGGTCTACTGTCAACTGCACCAGTCCGTTTACCTCTGCTGGGCCAGTGGGAGATGCGTGT
CGATCCACTCAGTGAGTACGCCTTCTTTCATCATCCACTGACAGGAGTTATCAAAGCATCACTATCACCAAAAACTGTCCATGCATCGCTTGGCGACACT
GCCATGAACTCGCGTCGTTCTGCTCGCAGCATCGGGACCTCTCGATCACTCCACTGGCAGTATCGCTATGGCTACGAATACGATGCTAACAGTAAGCTTG
TTACGAGTTCGAGGTCACAGCCACGACCTATTTGGACGGAGCACATCGATCCAGACAACGGAATGACCTACTACTACAACGCTCTCACCAATGAATATCG
ATGGGAGAAACCTGAAGACTTCGACACCAACTACGAGACGTTTGCTAGCGGACGCAGCGCGAGTAGCTCCGCTCGAAAGTGGTTTGGGATGGCCCACCGA
AAGGTTAATGAtgatggcagcagctctctcACAACTCGATCGTCAAAATCGCGCACCCTTGGTAAGAAGTGGGTCGAGTTAGTTGATCCAGAGACGCAGA
ACACGTACTACTACAATGAAGTGACAGGGGAGTCGCGGTGGTCTCTCTCGCCTCGCAGCGCTCGTGACACCTCCGACGCGGACGACCAAATCTCCCTAGC
TCTGTTCGCGCAAGTGAAGCAGCTCCGTGAGTCCCCTGTGCCGTATTCGTCTCGGGGCCAGCATATGAGTTGGTTGGAAGCAGCAATTGTCGAGAAGGAC
TGGAAGAAAGCTGACGCGATCGTCCAACAAATCTTCATTCGTGAGCAGAGCCAAGCGGTGACCGAACGCAGGGCTGGACTCGTTGCTGAGGATGTGGCTG
AAGCGCAGTCTGTTGTGGCAGGAACGACAGACCATTTCATAGggagcagcaccgccagttTAATGAACTCGAGTGCATGGATCGAATGCAAAGACGAAAG
CAGCGGAGCTACATATTACTACAATCAGGTGACAGGGGAGACAAGCTGGAGCGAACCATCAACTGCATCCAGTTCAGTCTACTACATGGAAGGTGGGGCA
ACTACTTCAGCATCGGCGAGTCAATGGGAAATGGTACAGGATAGCGACGGCAAGACATACTACAACAATCTGCTGACGGGCGAGACATCGTGGTCACAAC
CTACATGATACGCACGCCTAAGCAGCACAATACACAACGCATCCCAGGAACTATAACTTTAACTTTAACCCGCAGTACATACTACTCACAATTTGTGGTC
ATGGCGATAAGACCTTAGTTATGCCTCCAGTCCACCCACACAAACCATCTTCGTTTCCTGGTACTCCTCCAGACCCATGAACGAACCTTCACGTCCCAGT
CCGGACTGCTTCACACCGCCGAATGGAGCCTGCACGTTCGAGATCACGCCCGTGTTTACACCGATCATGCCGCAGTCCAATGCCGAGGCGACGCGCCACG
TGCGAGACAGGTTCTGCGAGAAGAAGTACCCGGCAAGACCAGCCTCCGTTCCGTTAGCCATTTCGATCACCTCCTCTTCAGTAGAGAACTTGAACAGCGG
CACAACAGGTCCGAAGATCTCCTCGCTCCAGACGCGCATCGTGTTATCAACGTGGGCCAGCACGGTGGCCTCGTAGAAGTTGCGTCCGATGTCACTGCGC
TTGCCGCCAACAAGAGCCGTCGCACCGTTCGTGACAGCatcctccaccagctccgacgtcTTCAGGAAGGCATTGGGGCCAATCAGCGGGCCAAGGTTCA
CGCCTTCCTTGCGAGGCGGACccatcttgagcttcttcacacgctccaccaacttggccgcgaactcgtcgtagaTGTTCGCGTGGATGAAGATTCGGTT
GCTGCACACGCACGTCTGGCCGGTGTTGCGGAACTTGGAGGCCATCAAGCCATCCAAAGCCTTGCCGAGGTCGGCGTCTTCGAATACAATGAACGGGGCG
TTGCCACCGAGTTCGAGCGACACGCGCTTCACAGTCTCCGCCGACTGCTCCATCAGCAGCTTACCGACCCGCGTGGAGCCCGTGAACGAAATCTTGcgga
cgtcgtggctgctggtcaGAGCTCCACCGACCTCAGCTGCTTTATCATTAGGGGACGGCACAATATTGATGACACCCGCCGGGATGCCGACGTCCTCCGC
CAGCTTGGCCAGAGCCAAGGCCGACAGCGGGGTCTCGGCCGCAGGCTTCACCACTGCAGTGCATCCAGCCGCCAGACACGGACCCAGCTTCCGCGTGATC
ATAGCCAGGGGGAAGTTCCAGGGCGTCACAATGCCGCACACACCCACGGGCTCCTTGATGGCCAGGATCTTGTGGTCGGGCGCCGAAGTGGACGGCAGGA
AGCCGCTCGAGTGCATGATCTCGTGGGCGTAGAAGTCGATGAAGCCGGCGGCGTAGGCCACTTCGCCCTTGGCTTCGGGCAGCGGCTTGCCGCTCTCCAC
GGAGGCGATGACGGCCAGGTCCTCCGTGTTGGCCACGATGGCCGCGTGccacttcttgagcagcacagAGCGGGCGGCAGGCGTGGTCTTGCGCCATTTC
TTCTGTgcggccagcgccgccgcgaCGGCCTCGTTGGTTTCGACGCGCCCCATGTTGGCGACGCGCGCGACCTCCTTGTCGGTGGCCGGGTCGATGACAG
CGAAGTGTTTGCTGGAGTGCGCCTCGACCCACTTGCCGTTGATGAAGCCGGCCGACTGGATGAGCTCCTGGTTGCGCACCTCGCCGTGGAAGAAGCGACG
CGAGGCCGAGGCGgcggacagcagcacggagcGGTGGATCTTGGACGACAGCATGGCGGACGGGCAGACGAACAGGCGGCTGACTGACTTGGGCTTGACG
AGGCAAATTCGGAAATGACCGTGGTGGCCGACTGCGGAGACTGCGGCTGAGCGGTAGTGAAGGATGTTGAACATTCCGAGGGCCTTCGGCCATTTACTtg
acttggcgtttgtatggAAGTACGTCAGCAAGTGCATTTTGACGTACGCTCGCACATTTGCCCGGTTACTGTCCTCGGTTTCCGGTGACGCGTTTGCTGT
CGGCCAATAGCAATGACACTGCCCCGGAAAAGCGAAGGCCGCTCCATTCATCACTTGCGAGCGTaccgagctgctcgcgctaTGGAGATGGCATTGCGCA