Description :
From Genome Similarity Track
Location :
Scaffold_182:121823- 134850
Transcript NameFunction/comments
Phyin_T30-4PITG_20787Putative uncharacterized protein

Sequence
13027 bases(100 bases per row)
TGACCTGATTAAGGTAGAATGTAAACTGAGTATATTTATAGGTAGATTAAAGCTTGGGTTTAATACAAACTATAAGTCACCTATAGAAATGCAATGTCGT
TAACCTGGTTGGCTTTGAACGACCTTGGTACATTGTACCAAATATCCCGAAGTATGACGTGTCATACTCCTGAAGTGTGACGTGTCACACTTCATGTAAC
CAGGGTACACTTAGGGCTACGTACCCCGTTACACAAACCAAGCATACTAGAATAACGAGATCTGTCCAAAACCGTTGCTTTTGTTTAGAGTTGATGAGCC
TTCTAAAGTATCCCAGATTTGTGACGTCACTAAAGCGCGAATGCACGATTGATTTCGAAGCACGACTATATTTCCGCATGCGGCCGCAGGAGGACAAATA
GAGTCTTCTAATTGGCTTACGGGGTAGGTGGTCGCACGCGACGAAGCTCATAAAAAGACGCTCATGCGGCAATTTGCCCGCATGCGCTAAACTTGCCGCA
CAGTAGAGTGTAGGGGTCGAGTGAACAATAACCAATCAAAATAATTTGTGACTCACGATCTTATGGGGGTGTCTGCTTCAACCTTAAAAAGATCACTTCC
TCTTTCGTTCGCGAGGTACACATTCGTTCACTACCATGTCTAACTTACAACTACTACTGAAAGCTGAAGAAAACGAGTTTTTTATTTAATTTTACCTGTT
CTCGCATCATTTTTGGTCAGCAACGATAACAGAAGCGATGAAATGCAGACAGTTCGTGATCGTATCAACTGGAATTCACATGCTGAGCGATTAGTTTTGG
AAGGCGAATTCAAACAGTACTACAGAATGAGCTCTGAGGCTTTTGAACGTTTGCTGTTGAACGTAGGTGGAGCATTGGTCATGGACCCGTTGCAATCGGC
ACGACGGGTCCGTGGAAAGCCTCCAGTGTCACCTGCTGGTATGCTACAAGCCTGTATTTCGTGGCTCGCTGGAGGTAGCTACCATCATATTCGGGTTATT
ACAGGGACCAGTCGCGCTGGTTTCTATAGAATTGTACATGCTGTGCTACGCGCAATCAATACCTGCCAAAAGCTAGCTATCAAGTTTCCTACTAGTGATG
ACGAAATGGAGGTTACAGCAGCTGGATTTCGATCTGTCAGCACTGGTGGTGTCATGCCTGGTTGCATTGGAGCAATCGATGGCTGGCTTTGCCCGATTCG
CGTTCCTCGGGCCAGCGAATGTGGGCGAGTAGTCTCTTTTTTTCCGGGCACTATCAAAGATATGGTCTTAATGTCCAAGCTTGTGCAGATTACATGTGCC
AATTCACGGCCATGGCTTGCCGCTCTCCGGGTGGTCGTAATGATTCTATTGCTTTCCTGCAGTGGTCTCTCAGTCAAGTTCTTTCGAGGTTACAAGGTCC
TTACTTTGTTGTCGCCGATAATGCATACTCTCAATCTAGAGTGGTCATGACGCCTTTTACCCAAGCCCAATTGAAGGGCCATCCTGAGCGCGACAACTAC
AATTTTTATTTGAGCCAATGTCGAATCCGGATAGAGATGGCCTTTGGGTTACTCGTCAACAAGTGGAGGGTTTTGAAAAGGCCACTTTGTGTAAAGCTGT
CTAATGCGTCGCATGTAATTCATGCTTGCATGCGGCTTCACAATTTTTGCATCGATCAAAACTCAATTGAAAATCCTGATACTGTGTCGCGTGAAATTAT
TGCGATGCGAAGAGACCTACGCTCATGGAACGGCTCGAGAGACCTTAATTACTGCAATACTCAGTACGAAACGGAAGACGGCGACCTCATTGAGCTTCTA
GATGCGGTATCACGAGATATATTAGTCCAGCATATAGAAGAGAACAATTTACATCGTCCTGGTCGCAACATTCAGCGTAGAATGCAAATGGATAGCAACA
AGTAATAGTATGATCAAATGAATATGTATCTGCTCAGCTTCCCAAGATATGTGTCTGTTCATCTTTCCAAGACATGAACTAATTCTCGTTGCCCTTTAAA
TCATCAATTAGCGACTGTCTTTGACGAAGAAGAAGGGCTCTATCCTCTTTAAGCCTCTCCATTGTTGCTTCGCCTGCATTTGCCATCTCTGTGTCAAGCT
CTGACAGCTGATGGCGAATATCCCGAAGCATTTTCAAAATGCAAGACTTTTCTTGTAGATGTGTGGAGGCCGAAGTACCGGCACGCTCAGCTTCCACCCG
ACGATCCTTCACATACTCTACAAACGCCCCGGTAAAAACCTCCATGTGCTCGCTATTCCCACGTTTCCCTTTAGACGGTGTAGGTCTGGCGGCCGGTGAT
TTGAACACAGCTTCTCCGTTGTCATCCAGGGTATCGTACTCGTCTGTGGACAGGAGTCCACCTTTTGCGAAGTTTCTAAGTTCTGGTTTCAGCTAAAGCA
CTCGTTAAGCATGCACATATACACAATTCACAGTTTTAACACTTACGTTAAGACATTTCTGCAAGTACAGTACGTATCCACAACCATTGACGAAATTGCG
GAACTCGTTTTCGTGCTGCTTCGACGTCGTGAACTTCCTCTCGGCAATAATGTAGAGTTTGTCGACCTCTTTCCACATTTCATAGAGTTTCTTTGCTGAA
TGTGGTTTGAATGTAGATGTGTCAATGCCCAGAAAGAAATCGTCCTCAGCTACCAATTGATGTAATGCGTGGTCTTCAGGGTACGTATGCATAAAAGCAG
ACCGAACGTCCAACCAGAAACTGCTTTTGTCGCTCACAGATCTTGTGTCCAGGTCATCACGAGGAGGTTTATTCCCAGACTCGCTGAATCGAGCGGCAAG
GTCGTCAGAAAACAGAATATTGAGTAGGCGATACATGCAGCGTTTAGTCCGAGTGCCGATTGCAGTTTTGCACACTTTGCCATTCGAAGATCCATCCTCA
CCAAGAAGTACACTACCGAAAGCTGCTTTCGCAACGTCGTGCCGAAGGAGAATGTCGATACGCTCGGTCTTTTTAATTTTGCTTTCACCCGCAGACCTCT
GCGTGTGCACTCTTTCCTTATTTCATCTGCTGACCACGAGCTGTCCACACTTGCCTGTGGTATTGGCTTTCTACTTCGCTTTCCATCTCTTGCGTGTTGC
GGGCCGTCGGAAAATGCGGGTTGATCACATGTATTCAATACGTTCTGCAAAAATGTTTCATTCTGGCTGTCGAGCTCAAATAGTCTATGCGGCATTGGTT
CTTGCATCTCGAGTTGCTGTTGTTCAAGCGCATGCTGCTGCTGTTCTGCATACGGCAACATATCTCGCTGCAACCGGAGTTCATGTTGCCCGTGGTGTGA
GGCTTCGAGGAGGAAGAGTTCAGCATCAGATAGTTCATGCTGCGAGGAGTTGCCAAGCTGCGAGCCTTGCCAGCCTTGGTGCTGCAAATGGTTAGCCGGC
CAGAGTCCGTGCTGCAAATGGTTAGCCGGCCAGAGTCCGTGCTGTGATAGCGCGCTGGGCGTACGCGCTGCCCGTCCAGGAGATGACATTCTGTATGCAG
CAACATGACTAGTGAGCTGCTAGTAAAATACATATACATGAAGTCCAGGTTCACTTACTCTTTGCTGGTGGAGTCTTGGAATGTGCCGGCTGAGATCACT
AAATATATATTTGTAACCACCAGCTGTCGTTATTAATTGCTCGCAGTCGCTGGTTTTGGTCTCAACCGATGCGGCCGCATGTTACAAAGCCATGCGCTGC
GGTGCGGTGCGGTCGTGCCGGTTGAGAATCAGCCTAAGTAAAATGGACGGTGTACACTGCTGTTTTAAAACCTGACCGAAAGAGTTCTGCCCTCCGCTCA
CTCAGCAGATGGTAAGGTGGCAAAAAACGTACTTATAATTCACAAAACACAAATACACTTAAAGAATTCAATTTTTTAATGTCCAAGTCTGGGACGCTGC
AATCGAGATCTTATAACTCGCAAACAAGAAACACTGTTTCACACAATTTTTAGTATAGACACCCCAAGGCAACAACTGAAAATGTTATCGGATCACAATT
TCGAAATTTCAATACTGGACGATCTGAAGTGCTTCTAAAATATGACTTGTGAAGCAAAGTTTAAAAGATAATATTTAGCTAAAATTTGGTTTGCAATTAC
AAAATGTAAATACTTTTATAGGAAAGAAAGTATATTTTTAATATAAAGAAACAGAGTCGAAGGAGCTGAAGATAAGTAAGAAATAAACCATTAATAGTAA
TTAATAGTAAATGTTGCTGGAAAAGTGGTTTGTAAATTAAATTATTAGCTGCGAACTTAAGTGTACTGGTTTTTTGTTCAATAACTGTCTGGAAATATGG
TAGCTATATCCCAGAGTTATTTGTACAGACTGGAAGAAAACAGTACTTTGTACTGTTTTCTGGAAATTCCTCCTCTCTTCTACTGAGACCACAGGGTTTT
ACCGGGACTGGCGGCCCCTTTCAGAATCAGATGTCGCCTCTCTAATTTTTTGCTCAACAGTTTACTGCGAAGTACATATTATACTTATTTAAAGTTACTT
GAAGGCAGCAGTATTTGCTCGCTGACAAGCCATCGTTGACCATGCCATCATGACACGAGCGCTATTAAGCAAGTGAGCGAGAGAGCATTCCTGTAAGTCA
CATGCGAGGTTGCAGTCGTTTGCCCTGAGACCCAGCTCACAACGACATGCATGCCACTTGATAGGCTGCTCTAGAAAGGGAATACTAAGGAAACCATTGT
CGAGCATGTGGCGGTACGGCCGCCTCTTGCATTTGCAAGATGATAGGCGTGGACAGACAACGTCGCGCCCGTCGTCACATTGCAAACGTGCTTAGAGATC
TGCTCGCCGATGTTGCAGAGGGGAGACAGGAAGCCAGCGAGCCACGCTTCTTCCGCCGTCGTGTCATTCACCAAACGGCCGCGGGCAGGAATTGTTCGCC
CCACCCGGTCCGGGACTAGCATATTGCGCTAGTATATCGCCACGCTCGCAACTTCATCTTGCCTGCTTGCCAGTCGCGCTAAGCTTGACAAGACGATTGG
TGTCCATTCAGACCGCGTCACTCTGACTACTTCAATAAACGAAACGGTAACAGCTGCGTGTGGACACCACCATGAAGTTTCCGCTGCCCAAGAATATCTT
CCCACCGCTGGAACTTTCGGACAACCAGGAGCAGAGCTACGAGCAGCTCGCCAATGCGCTCATTAAGGCCACACTCACCGAGTATGACCAGTTTGTCATG
CACGACCGCAAGCGCGTGGACACCAAGCGATGGAAAACTGTGCGCACGCGCGACGGCGTGTCCATCTATCGGGAACGAGTCATAGACGGCGTGCGGCAGC
CGGATCAGGCTCCGGCCACTCTCGCGCTGTATCAAAGCGCCATCTCCGCGGCCAGCAGCCGCCCCAGTCAGAATGCACGCCGGTCAGGTCCTTTGACCTC
TGACACCATATCTCTTAACAGCGGACGCGGCTTCATGCCTCCGTCACCCAAGAAAACCAAGGGCACGGACCCCACCGAAGACAGCCGCGATACAACCGGC
AACGACAGCTACAGCAGCGGCGGCTTGCTGTCGGAGCCACGTATCACAACCGCGGCCTTTTCCAGCACTGACGATGACACTGCTAGCTCCGGGTTACCGA
GATTACTCGCCGTGGGTAACCTGCGTGGCTCCCTTGACGACGTCATGTACGGCGTCGTGTCACCTAACGCATCGTCCGTTCGCCTCCGCAGCTCGTATCT
TGGCGAGCACATCGCCGACTGCGCTGTGCTGCGTGAGATCAAGAGTCCGTCACCTGCCGACCCGTTCCGTTTTCTGGGTATCAAGTGGTTCGTGCGCGCT
AAGCACCGCGGCGCTGCACGCATCGTCCTTCCCCGTGATTTCATTGTCCTGGAGTTCTCCGGCGTGATGATGCGTCCCGACAACTCCCGCGTAGGCTTCC
ACCTCATGCACTCAGTGGATATCTCCACATGTCGTGAACTGCACGAGCACCGTATCCTGCGCGCAAAGGTGTCGAGCTGCTATATTTTCGAGGAGACGGG
CAACAACCGTGTACAGGTATACATGACGGCTTCCGTTGACCCGAGTGGGCATGTACTCAACCGTATGGCCGTGCGGTCAGCGGCAACGGCGCTTAGCAAC
TGCTGGAAATCTGTGTCCTGCGCACATAACAAGAAGCTCGCATTCTGTCTAGAAAATGAACGTCCGTCCACAATGGGAACCAGTGGCATCACTTCGTCTC
GAGGTGGCCACGCACTATTAAGCGCCAGCGTTGTCAGATCGTCTCGAGGCGGACTCTCCGCGCTTACCCCAGTGAACGAGTCAAGTTTGCGCGAATCGAG
CGCGATGGAGCCTGTATCTCAACGCAGCAACTACAGCTCCACAACTCTACGCCGTCAGTGCGGTGTCTGCCGCGGGAAACTGGGCGTGCTGTCCAAGTCC
ATTTCGTGTCAACTGTGCTGCGAACAGATCTGCAGCCGCTGCCGCATTGTGCGTAAGCTCAGCAGTAATACTCTGAATTCGCAGGTCACACAGTCGTCCA
TTAACTTTTGCAAAAAGTGCGTCGCCAGTGTTAGCGATGAGAGTGCTCTAGAGATCGCTCGCCAGGAGCTTTGGGTCCGCGAACGTGGCCGTACGCGTGC
ATCTTCGGCGATCTCCAGATCGACTATGAGAAACAGTTTCTCATCGGAAAGGAACACGTACGCTACGGTGGTGCTCGGCCGAGGTAGCGACATGAACAGC
CGCGGTAGTACTGCCACTAGCAGCCTCGGCTTCAGCCGAGGCCCCAGCAGCTTTAGCCGTGGTACGAGCAGCTTCAGCCAGAGCCGCGGTCCTCAGCAAG
AGGAATCAGCTCTAGGCTACTCGGTTGGTCCCCGTCCATCCACGTCGACCCGGTCCTCGACTCCACTGCAACGCCCCAGCTCGGGTGCCCGATTGTCGAA
GAACTTCGTGCTCACCACGCTCAGTACGAGCGCTGGTCCCTTGTCAAGCAGTACGCTGACAAATGATGTGCTGTCGCTCGCCGACCTCGGCAGGGACAGC
AGCAGCATCCGCCATAGTAACAAGAACAAGGCTGCAGCTGCTGAACACGACAAAACTGAAGGCGAGGAGCCTGTAGTGCTCGATCACCGCATGACCATGA
CCATCCGCAGCCTGCGTCACCTGGACTATGTCTTGTCGGTGGGTGAACAGGACCTTGTAGACGAGCTTGAGAACGAGGACTTTGGGTCAGAAGACTATGG
GGGATTCGAGAGCGGTGACGACGGTGAGGGGCGATCGAGTTACGCGTCGTCGGTAGCTGTGCTGGACGATAACTACGAAACGTGTGATACTCCTACGAGC
GACGCGCCTCAATCGCAGCGCGAGTCTCCAATCGTCGAAGGAGAAGAAGATGAAGATAGTGACGAAGAAGTGAATGATGTGGAGCAGCCAAAGGATGATG
AGAACTCAGCGGAGCAGGAGCCCGACGAGAAGGCTGTCGGGAGTCCACAAGAGAAGAGGAACCAACGCCCCCCGGAACAGACTCAGGACGATACGGAACA
GCTGCCTACAGAGGCATTGGAAAAATCCGTGGTGATGGCAATGCCGGTTCATGAGAATGACGACCAGCAAGACGAGACAGCGGCTGGGGATGTGAAGGTG
GTGGAAGCTGCGCCCATCGCCGAAGTGCACGCCATGATGTTGTCCCAGTACGAGATGCCGAAGTCCAAGCCCGAGCCGGAGGAGGACCCGAAGCCGCGCC
TGCACCGTGCACACACGACGGTCCCGTCCTCCGACGGTGAAGCAAACTATCAGCACCAGCTTTTCCAGCAGATGCAGGACCTTCACAACGTGGTAGAGTC
GACTTACCAGGTGGCACGAGCGAACACGGAGGCGGCATTCAAGGAGCGCGACAGTGGCCGCATGTCCAAGGCGTCACCGGACGGCACGACAGGAAACCTT
CGCGGCGTACGGACATTCTCTCAACCGTTCGCTTTTAACGTGGTGGGTCTGCGCTCGACGCGTGCTATGACCGTCGGCATTGAGAAATAGGCGCCATTAT
GAGCTGTGATATTTATCGCGAAGCTGGTGCAACCAATTGATTTCGAAACAAAACAAACGTTAGCTTTGCTAGTCTTTTGTCTTCGTTTTCATTAGTCTCC
GTGCGAGCATTAAATACCTTTATGTTTCTTGACAGCCAATCGCTTACGTGTAAAGTGAAGTAACAGGCAATCGTCGAGATTCTCGCTGCTCGACTCGAGA
ACAGGGCAAAACAAACGCCCGCTCGGGTGGACAAACAGCTTTTTCGTGCGGTTCATGCTGATGATTCGGCTAGAGCCATGGGGACGAACGAGCCTTATTC
CACGATTGTTTCTACCGGATATGGCTCAAGGCAAACGTTGCCCACATATTGCCGTACAACTCTGCTGCTTCCCAGCATGAAGTTCCTGCAAGTGAGCGAG
TGGATATTTCGTGTCAGTGCCGTCGGGCTCACTTTGGGGTGAATGCATGTACAACCGACTTGGACCTAAATGACGGGCAAGTGTCCGTTAAAGACTCATT
TATCGCCGGGCAGTGGTGAAGAATCCTCTTCTGCGTGTCTCGTGAAGGCATTCCCTTGGCAACTTTGACCAGCCAGCCGTTCCTATTCGCGACAGTTGTA
ACGGAACCTGAACACTGCATCGCAGCGAAAGCCAAGAAGGCGCTTGAACCGTGGTTCTCATTTGCCCACTGCCGTATTATGCTTACCGCTTTCGCCATCT
TCGTTTCGGGGTGGGTGCACCGATGCAGGTGGCTTAGAGCCTTGTGCTCACGCAAGGGGTGAATTCAAAATCTGCCGACCCTGGGCGCAAACAGCTTGCA
CGATTGAGTGCAGGTGCTGCACCGAATGTCAGCGGTTGCAGCCAACTTCGCCAGGTATAATAGGACGTTCTCTTCAAGTATATACTGTACATCAATTCTG
GCGAGAACTATTAGCAGATGAAGTTCCCTTTGCCTCGTGCGCCGTTCAGTAACTACCCCACCCTGTCTGAAGCGCACGCCGAGCAGATTAACTGGCTGTG
AGGCAGACACTTTCAAAGACTCTAGTGGATTACGAATCCCACCAGCAGAAACAGCGGCGATTATTGCCACGCTCGCAGTGCAAGGTCGTCAAGAAGGCCG
AAACCCTTATTTGCTACCGTCAGCGGTCTGGAGTCTCACCAGACGTAGTGCTAACACTGGCACCAGGACCCAGCACGTCACTCACAGACTCGTCGTCTTC
GGTATCATCCGTGGCGGGCATCGTATGCGGACACAGCTCGCAACCAGGGCATGGGAAATACAATACCCAGTGTTATTTTGCGTGAATCACATCCGTAATA
AAGACTGCAATACCTGGCAACACAATAATAATCACTGCAATAATCACAATATATTGCTATCACTTAGTCTTCGATGCAACCGAGAAGGGTTGTAACGGGG
TACGTAGCACTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGAGTATGACATGTCATACTCCGGGATATTTGGTACAAGGTACCAAG
GTCATTCAAAACCAACCATTGGTTAAATGACATTGCATTTCTATAGGTAACTGATAGTTTGTATGAACCACAAACTTAACCTACCTATAAATATACTCAG
TTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAATTAAAGAGGGGACCAGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAAC
TTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCATCGCGGGTAGACTACCTGAACCTCCGAAGTTCGT
TGCCATGGATAGGAACGACTTCTCCCATATGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNN