Description :
From Genome Similarity Track
Location :
contig_75:121790- 126818
Transcript NameFunction/comments
g10005.t1hypothetical protein

Sequence
5028 bases(100 bases per row)
AGTCCAAGGAACTGCCGCAGTTCCTTTACGTTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCA
CGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAG
ATGCTCTGTATGCATCTCCACATCCGATTTCCCATTCACAGCCCGGCTGTGAATGAACACGTCGTCGAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGC
AACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATCACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCG
CCGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGAT
CACATCTTTTCGAGGTATCGGCGTCTGCGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGTGCCACCCGCCCTGTGGTTTCTTCACA
CAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGACCTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCAGTACTTCGTTCCCGGCAC
GAGATCAATCTCGTGCTGAACACCCTTGTCCTGCGGTAACTCCGCAGGAATGTCGGCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGGG
CTCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGCTGATTCAGCTCTT
CTGCTTCACATGTCATCCTCTCGACGTCCGAGAGGATGCAGATCTGCTCGATGCGTCCATCGTGCAGTTCGCGAGCGAAACGCTTCCAGCTTGTGACTGG
GAGCGACATCAACTCCGACGCTAACGTCGGAGGATTATTCAGCCTCATCTTCTTGTATTGGAGACCAATACTCGTACGCGTCAAGACACTCAATGTCTCG
ACGGTCGTCTCCAACTCCTGTGTCTGCCCGGCAGACACTGCTTGTAGCGTCTCGGTCCCTGACCGAGACTTGCGCAGCTTTTCTCGCTTGCGCCGTTCAC
TTCTCGTGCGGAGCCCGGCTCCGCGAGTTTCTTCTTGTCCAGACCCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGGTTTTACCCGCGGGCGCAC
GCGTTCAAGCCCGGCTTGATCGCGCACCGCTTCGTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGACGTTTGCAACCGTCCGCA
CTGCTTGCAGCGTCGGCTCCCAGAGCCGATGCGTCTTCTTTACCTCTACGCCTAACGGCGGAGTGTCTTTCGACAAATTGTGTGTGTCGACACGACCGCG
TCGCCCCGGACGCTTCGAGACCCTCTCGAATCCGATTGAATCAGGCCCTGCTGATTCGTTTCACATCTTCTTCCAACGACTCTCGCAGTCGTTGGCGTTC
GCTTCGGGTGACCGGAGACAGCCGCATTCCGCGCTGTCTCTGATGGAGGGCCGCATGCACCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTC
TGTCGCGCTGCTGCTGCTCCCGAAGCGCGCGATCGTGCACTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCATGGCATGCCCAACACCATATCG
AACTTATCGTCCAGTTCGAGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGGTAAGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGA
CACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTCCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGC
ACCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGTTTCTTGCAGTGAGATTGA
CTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTTTAATT
TTTTATTGCCCGTGACGATACCCAGTATCGCCACTTCGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCATAGTGACCGATGTTTCCGCAGC
GGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGACCAGCAGCGGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTTCACCG
GTCGTGGCATCAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTTGG
ATACCTCGGAAGAGATAGATCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATATTCG
AGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTCTGCGGGGG
CTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCCTCGTACGTGCTAAAGCACGTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCG
CCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGCAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGCT
CCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGT
TCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGCGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTC
GTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTTTTTGGGCTACCCACGGACATGTTACTGTC
CGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGTCTGCTTAG
ACCCACTACTAAGCTTACACGTGTGCGCACGTGTATGAGGAAGCGTAGGAGTAATTTACTTAAGTTTAGTATACTTGTATCCGCAAGTATACTGAAACCT
AGATAAAGGAACCGAACGATAGCTTTGGTGCCAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTG
CCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGAC
CACCCTGTGGTGGTCACCTGAATGTATCCCTTAGTGCATGTTGCACTAAGGTAGGAGGTGAACCGAATGTGTAGCCCCGCTACACGCACGCTGAAGCCAA
ACGAGCTGAACTACGACATCGTCGAGAAGGAAATCTTAGCACTCTTGCGCGTCTTGAGTGACTGTTTCACGATGCTGGCCGGGAAGACGGTCCGCATCTT
AACCCGCCACACGACGATGGCTTGGTTGTTCCGATCTAAGAGACTGCAGGGACGCCTGTCACAGTGGGCCGCGATCTTGTCGCCATGGAAACTGAACGTT
TGCCGATCCTCGATCTAGTGTATGTTGGTCCGGAGTTGAGACGCCAAAAACAGGATAAACATCAATGCATGACCGTGACTCCGGAAAGTGGTGACCCTCT
TTCAGATGAACTTCGTCCTGAACGAGTTCTATCGGAAGGTGTACGGCCGGAAGTACAAGATCCGGATGTACCTGTTGAGTTCCGATTGGGACCAGGCAAA
CGATATGGCTGGTGGGAAGACCACTGTTCAGATGACACGAAGCGGATTGCGATGGTTCACGGAGTGGTAAACAATTGTCGGACAGATATCCTTTTGGATT
CCGGAGTGTCAGTAAGCATGGCGATCTTGCGCGTAGACTCAAACTCAAGCGAAGTTTCTGCAAACAGCTCCGGGTATCTGGACTGGGTGGCGTTCCGACC
ATCATCACCGCGAGTGCTGAAGTGAAAATCACTTTGGGTCCGAGAACTGTGTATGTCTTGGAACTTTGGGTCGCGAACATTGGTGAATGTGTCGACGTGT
TGCTTGGAATGAATTTCATGTATTCCGCTGGAGTGCGACTGTGCGCACGAGAAGGATTGGTGCAACTTCCGGATGAAGAAACTGTGTTGCTATCAGGACG
TGGTGCGGATCAGTACCACAGAGGTTTGGACCTTCCGGTGAGACCGCGTGAAGAGCTTTTCCTGCGCCCAGGTGAACATGCTATCGTCCGGATACATTAC
GGACAGAGCAATCCACAACGTGATGTGGTATGAGCTGGTCGAGGAGACCGATGGGTAACCCAGATCATCTATGCTGTCCCGGCGAGTGTCCTTCATGAAG
GTGACGAGGGCTGGGGTGAAAGGAAAGCTTTCCTTGCGCCCTGCCCTTTTATCGTCTTGGACAGCTTGTTTCCTGCGTACGCTCGGAGCTTGTCACGCGC
CCGCCACCACCCGTCCACGGTTCCATGGGGGTACCGAAGCTCGTCGCGGTCAAGCCGATCCGCTCGATGGAGTCCAGCGCCACCAGCTTCACCTTCACGG
TGTAGCTATGTTGCTTCCGGCATTTGTTGCAGTGGCAGGACTGGCCGGTGCCTCGGCGTTTTAGCTGCTGGCCATCCAATTTTTATTTTTTTATGATTGG
TAAATATATATTTTTTTCTAGTAATTTG