Description :
From Genome Similarity Track
Location :
scaffold_25:121739- 123805
Sequence
2066 bases(100 bases per row)
GCGGAGATCGTGTTACTAAAGTCGATGGTCAACTCAGCGGAACGACGCTCGTCATTAGTTACGGATGATTTGGTTCTCGAAgaatttcgacagcatgTGA
AGTCACGCAGATGATCTGATCTTTTAAAGAGTCCAACTGATCCTATTTATTCGCTAGTGATGAAATACAAGAATGACGCCCTTAGTACAACCCACCCTCC
ATTCTTTCACCCGAACGTGTAATTCGATACGAAATTAATCGTGAACCTGGTTCAAAGTATGCAGTGCTTtgacagtggccactgtaGCGTGAGTGAAGCG
AGTACAGCAACAAGatttttgctcaaaagcaaaTTTCTGGCCTGATAAGGGAGTGTTAGTCCTCCCACAGCGCACCGACGTTTTGTGTATGTAAACCAAA
TGGTGAATAGCGTTTCGTTCACGCCTATAACAAGCCAAATGCACAGACGATCCCTGCGCAAAAGCCGAAGCCGCGTACGGATGTCATCAACCACCAATTA
GTGTacttgatttggtcgatAGGCATTACCAAATCGTTATGAGTGAAGAGTACGTCTCATTGAAAAGTGTAAGTACACCGTCCGGTATGTtatgggagtg
gcttgtgatgccacaGAGCCTATGCAATACCCCAGCAATGTTCAATCGATTGGTGTACTATCTGTTTCGACTTCgcgcaaacatacttcgacaatAATCT
CGCTCACTCGAAGGACAAAGATGGCAGACTGCCACAAAATATACACTTGAGATACCTCCGTGTGGTGCTAGAATGTATGCGCGAACATCCATTGCAAATA
AATCTTACGAATTACCCGTCCTCGGTTGTTATGCTGGTGAACACGGTATTCGAACATATCCTGAGTAAGTCAACGCAGTCGTGACCAGCGGCACGAAATT
AAAAGGATTGAAGGAATCGAATTGCTTTGTCTGATTACCTGCATCGCTTCTCGCAAAATTACGCGGAAAACGTACGCCAACATCAACCTTGCTGAAGAAG
GCCGTTCCATAAAAGTGGTCATCCACTAGTGAAGAAGAAACCAAGAACAGCGTGATGGAAGCTCCATTACTAGCAATACTAGATGCTACGAAGCCGTATA
GGGTGGAgtgtgacgcttctgagtttgcaatAGGTTGTGCATTATCGCAAAAGTACTATGAAGGACACTGTCGTGTCGtttcaatcgcgacagctgaagc
caGCAGAAAAAACTACTCTGGGAGCTTTCAGCAATGAAATATGCTCAAATGAAGCATCGCGTTCACCTCTTGGGTTCAATCCTTACAACTTCATGGTCGT
GTCCAAACCAGGAAGACTAAACATGCTGGCAGAATCATTGTCACGCCGTTCTGATTATGATATCAGCTATATCGAAAACGATGTATTTGATAAGATCCAT
CGAGCGTATGCTGAAAATGAACAGTGTGATTTATCAGCGCAGTGTCATCGAAGATATATAATTCCATCACAATCTTCCTGGTCGCTCGAAGTCTAGGTTG
CATCGTTATGCATGGAAGAGTAGCCTCCTTTACTATGAGCTAGGATGTTGCACGTGTCGACGAGTCACGGATGGCGCATGATACGCCGATGGCCGGTCAC
TTTGACCGTGAGGAGATCAACCTGCCACATTATGGTAGCAccacatgtacaagtgggtgGCATGATACATGAAGACGTGCAATGTCTGTCAGCGCGTGAA
AAGTGTATGGAACATGCAAGCTTCACTGCTGCGGAGTCTTCCTGCTCTTTTGACTGTTGGAAGTCTGTCGGTCTCGACTTTCTTCGAGAATGCTGATGGC
CACAATGGGGTGCTCATCTTTGTtgacagactcagcaagatgattCTCATCGCTCTGTCAGCGATTCCAAAAAAACGAAGATCCAGCGAAATTGTTCGTT
GatcacgttctttgcagccacAGGTTGCTAGACGCAATCGTCTCTGATCGTGATACACAATTCACTAGTGGCTATTAGAAAGAATAGTTTTGAATGTTTG
GCACTCGCCTGGATATGTCTACACCGGTACACCTGAAGACCGTTGGGCATACACAACGTGCCTACC