Description :
From Genome Similarity Track
Location :
Scaffold_4:1217331- 1248487
Transcript NameFunction/comments
Phyin_T30-4PITG_03259Putative uncharacterized protein
Phyin_T30-4PITG_03260Putative uncharacterized protein
Phyin_T30-4PITG_03261Putative uncharacterized protein
Phyin_T30-4PITG_03262Double stranded RNA binding%2C putative
Phyin_T30-4PITG_03263Putative uncharacterized protein
Phyin_T30-4PITG_03264Sodium/hydrogen exchanger
Phyin_T30-4PITG_03265Sodium/hydrogen exchanger
Phyin_T30-4PITG_03266Putative uncharacterized protein
Phyin_T30-4PITG_03267Putative uncharacterized protein
Phyin_T30-4PITG_03268Putative uncharacterized protein
Phyin_T30-4PITG_03269Putative uncharacterized protein
Phyin_T30-4PITG_03270Putative uncharacterized protein
Phyin_T30-4PITG_03271Putative uncharacterized protein
Phyin_T30-4PITG_03272Putative uncharacterized protein

Sequence
31156 bases(100 bases per row)
TTTTCATTGTTAATCAGTGTAAAGCCACTCGTTCCTCTGCTTCTGCTTCTTAGCTTTTTTCTCGGCTGTTATTTTCTTCCAGTCGATGTTTTTGCGCTTC
AACTGCTCCTTCCTGCGTCGTGCTTCCTCGCGGTTTTTCTCTAGCTCACTCATGTCGAAGAAGTGGCTCATTTGCCGCCCAGCACGATCGGATGCCATTC
CTGCGCTTTGCCAATATTCATCACCCCCGAGTTGCTCGTATTTGCCGGTAAGCCGATTAAACTTCGCCTGTGCGACGTAGTTCACGCCAGAAACTGTCTT
CTGACTTGGGCCACTCGAATCTAACTCAGGAACTTCAGGAGGTATCCACTTCGCCAACTATATATAATAGTGAGCACGCACAAACAGTATAAGCGCACCA
AACACTGTTAAGTAAAATGATTGAGCGTACCCCCGAGACAACTGGTGCATTGGGCTTGTTCCACTGGGTCACCCCTGTAACCACATTGTGGTAGTAGTAT
CGCTGCGTCTGCGCGTCGACATGTTGCTGCCACGCCGCTTTTGCTGTTCGCGTGGTAGCAGCATCGCCCTCTCCATCAACAATAGCCGTCGTAGAAGGAG
CGCTACTATCAATGCCGCTCAAAATGGCATTAAGCTTGCTGAGGTTGCCTGAAGGGTCCAGTACTTGCTGGGTCACTCGAGCCAAGTGTTCCGTCTGCAT
TCGTTTAAGATGAGCATGATACTCAGCGGAGACCTGGGTACCCACGGGGGTTGCTGGCTCTTCAAAGTCCTCGGGTTCCTCCCACTGCGTCTTCCCTGTG
CTGGCATCGTGGAAGTATGGCTTGTTACTCGCAGCGTCCACGTACTTGACCCAATGTTGGGCCTTAGCATCAGCAGCATTATCCTCCAAAGCATCCTTTG
TCTTCTTTTCATCACTTCCATCATTGTCACCTGTAGATTCCTCTTCCTTCTCCTCTTGAGGTTCCTGCTCTGGTGCTTCGGACTCCTCTTCCTGCTTCTC
AGTTTTTTTATATTTCTCCTGATCTCTACTTTCTTGTTCTGGTATGAAGTCATCTGGTTTGTCCCATCGGCTGGTGCCGCTCATCTTGTCGAAATAGTAG
GTGGCTCCAGACTCATCGTCCACGAACTCGAGCCACTTTGGGGCCTTATCCTGGCTCGCATCTTCCTTCTGCGGAGAATTAAAGCCGGCAGGGACCTCCC
ACGAGGACTCGTCTGTGCGGGCATTGTAGTAGTCCATGGATCCGGTGGCCTCATCCACGTGCTTTTCCCACTCCGCGTCCTCGTCAGACCCTTCGCTCGT
GGTTGTCATACTCGAACGTTTTAATTTAGATCTTCTAAAATGTTTTTTCTGGACAAATTTAGATTTGTTTAATCCTAATTCTGTAGTTTAACCCATTCTG
ATCTGGAACACTTGCAGAGCACCAGACTGATAGCAAGCAGCACAATGCAACAGGTAGAACCCCCATGTGCGTTTAAAGGACTCGGGCAGCGACGGCATGT
GCTGCAATTGAGTCATTTGGACCATTGTCAGGGCTTGGCCAACTCTATTAGGTGCTGAGTCGTGACCCCATTGTGCTTGGAATCGACGGTTCCACTCGAG
GAACGTGCGTTTGTAGTGATCCGAGTAGCCAAGCGTGTCTCGAAGTGTGAAGCCCGTCTCGCCAGCTAATCGACGCATAAACGGCAGAGTAATGGCGTAG
CAAGGGTACGCGGTGTGTACGTATTTGTTGGTCCAAGCGTGAGTCGCCATGTGCGCGGCTGTGCAGGCGCTAAACTCAAGCACCGTCGTTCCATTCGCGG
TCTGGATGCGCTTCAGTGTTCGCAGGAATCGAGTTCGCTGCACATCTGGTATGGTTTCCATTACACCACACAGCGTGATGCGGTCAAACATTGAAGCACG
GAAGCCACTCAAAAGTGTAAGTAGCTTTTCAGGCGTCTCAGCGAGCACGAACTCCGTTTGATCAAAGACTTCAAGTTCACGGGCGAATTTCTTGGCGCGT
GCGAGCTCTTGGACCGACGACAGCACGGATACTACGGTAACATCAGGGTGCTGCTGAGCGAGGAAGCAGCCCACCCCTCCCCACGACCCGATGCTGATGT
CCAAGACGGTTTGGCCAGTCTAAAGAAAGTAAGAGATGAGCTTAGACGACCAAAAAGCCAATTGATCATGCGCCTACCTGAATGTCTAGCTGCTGGTCCA
AATTGGCAAGCTTGTTGGTTTGTGCAGCGTCGATGGTTGTTGTCCCTGCTGACCAAATACCAAAGCCTTGATGGAAGTACCGGTCCATGTACGCCTGTCG
GAATTCGGGACAGAGATCAAACTGCTCCGAGACTGCACCAACAACGAGCCCCATTGAAGACGGAGGATAGTTGAACAGCCTCGCTGCCAGTGCCACAAAA
CGAGCGCTCCAGGATCGGTACATCTCTTGTCTGCCCTCCATCGGAATGGTAAGCAGGCTAGCGACCACTTCGTCCAAAGTTCGAGCGGAGTTTGTCGCCC
ACAGACAGCCAACGTAAGATTCGCCAATTGCTACAAGCCCCTCGCTCATCCAATCCAGCCAAAAAGAGTCATCTCGGACAATGAAGTCCTGCACCATGAG
TAAGTAATAATCAACTTGCTAAGACAGAAATGAACACCTACCACATTGGGTCTAATACCACCGCTGGACAGTAAACGGCACATGATCGTCTTCGCGTTCC
GACGCAATCTAGGCAACGACAGCGAGCGGATCAGCTGAAGGCAAAACAGAATTGCCCCTGCGATCGCCGTAGCGACATACACCCAAAACGATCTCTGCCG
CAGCATCAACACCAAATACCATAAAGCGCACAACTATGATATTAGAACGGGACTTTAGACGCGTACCCAGAACTTAAGACACAACAATGGTGTCTACTTA
TCTGAGCAGAAAGCGCAAGCGTGAGGTATGTACATTTCAGTTTAATACCTGATGTGCCAGGACGCAGAAGAGCGGGACGAGCAGGTTTAGCAGGAGCTCC
ATCTTGTACGCTGCGTTCCAAAAGCGCTGTGAGCGCGGTGGCGAGAAGCGGTAGATGTGATCAGCCTTGGGAAAAACCCCGCCGCCCACTACAAAATGGC
TCCAAAGTCGCGATGATCTGCTCAATACACGTTTCAAAACAGAAATCTGTCAGCACCAGAGCTCAACACGAAGTCAGGAGCGTCGAAAAATATCCTACAT
TAACGCAGGCACACTCATCCACACGCGGACGAGAGGGAGGTAGCACGAGACTAGCAGCATCGGCACGAGCAGGTGTAGCATGATGTCACCGACACGCGCC
GCGAAGCCGAGCAATGGTGAGCTGGCCCAGACTCCGAGCCAGCCGTTAAGGATGGCCGTGAACGCGTACCGGTCAAACACGCGCAAAGAGTACCAGCCTA
CCATGATAGTGATGCCCATGGATGTGGCAATACCCAGTGCTGCCTCGGATGCCAGTAGATGTGCGATCAAGGTGAAGACAAACCAGCAGTTGGTGTACAT
AGTGCGAATTCTCACAAGTGGGGGCAGCATCACAACGCTGAAGAGCAACGCGACATCCAGCGCGGCATCCATTTGACTGTCTACCTGTACGGTGTCGTGG
TTGGCGCGGCTTAGCGTCCCCCAACCCAACAGTGTGTCCATCAGAACTCTTTGTCGAAAGTGGCATCACCAGATTAGTGCAATGTCGATATCCAAAGATT
CACCGGTTTTACACACTGTGCTGACCGGCTACCTAAGGATATCATTTTAACTGTTCGAATGATGACTGCACGATACATGTATCTGTAGTTACTACTGTAC
CGGTACTTCATTTACGCCGCATCGCTGCCTGAACGAAGTGAGCTTTACCAGAACACTCATGATCTCAGCGATTCTTTTGTACAGGTATAAAATTTATGGG
GGACTCATATGTACTGTCTAGCTTCTGGCGAGGTGAAGGCTGCAAGATTTACAAGCTCGGTTTGAGCAAGCAGTTGACGACAAACTCGTGAAAGCCTGCT
TGGTAGGCGAGCACACAAAATGTCGGCACGGTAAAGTTGTAGATGAGCTCGATCTTCCGAGCCGCCAGCCAGAACGACTTCGGGCGAGGAGGATAGATGT
GGTAAACGTCGTTGCCAGAAAGACAAAGGTCTCCATCAGCGACCAGCTTAATCCAGAGTTGAGAGAAGCTGTATGCAAAACAGTCAGAAAGGTATAAACG
CACAGCTCTCAGACCACAAAGCTAACACGACGTACATTAAGATTGGGAGTGTCATCCAGATCCGTACCAGCGGCAAGTAGCAGAAAGCTAGAGTAAGCGG
TACACCCATGTGCAGCAGAAGGTCGACGGAGTTGGCCAGGAGTCGGAGTGGCCAGTACTTACTCAGGAATCCGAACCAGCCTTGCAGGATGCCCATGAAC
GTGGTGCGGTCGAGCATGCGCAGCGAGTACCATCCCATCATGATGGTGAGACCTAGTGACGTGGCCATGCCCAGCGCTGCTTCCGACTCGGTAACGTGCG
CCAACACGGTGAAACCTACCCAGCAGAATGTGTAGAGGATCCGCACGCGTACCAACACGGGCAACAGCGTCATGGCGAGCAGCAACACCACGGCCTGGAC
AACATCTGGGCTCAGCAGCGTTGCTGAGGCCGCGCGCTGCTCGCCGTTACGCACTCGCAGCACCGTGCGGGTCAGCGTGTCGTGTGCCACACTAAACAGC
TCAGTGGCGTCCATGGCGCTACGCAGGACAATGATCAGATCGAAAATGACGCTCCATTCCAATTTTTTAGACAAGTGGCGAGACCGAAAGTTGCACTACC
GATATTTGCTCCGCCATGATGATTCGAGATTAGGACGCGCCTACTTTACCACTGTCATACTGTATATTGCACTTGCGTTTTATCAACTTTGAGAAAACAG
TACTAAATAAATAGCCTATTTACAAACTTATTTTTAAAATAACCTCGGATAATACGTGTTTGAAAAACAAAGAGTACACCAAACTGTAAACACAATGCCA
AATGCGCCTGCTTTATGTGGTATTGCGACTTTTGACACCTTACGCATCATAATACCGGTATGACATATTATGTACATATGTAACGGTTTCAAACGCTGAT
GTTGTCAGCTAACAAAATAGATCTCGCAGCAAAATTTGAATGCTTCCAGGCGATTAAACCGCGGGATCTTACCGGATACATTACCCTCAGAGTCCAACAG
CCTCTTGTTCTTGCTGCACGTTCAGGGGCTCCATCTATGGTGAAGGAAGCGATTCGCCGTGAATCTTGAATTTTTCAAGACGTAGATTTCTTGCTCAAAT
TCTAAATGTTAAATGATGAACAATGGCGCAGCCTTCTGAAAACCGCAGGTCCGGCACGGCACTACACTGGGTAAGCAAGCATGCAGCCCAGCGGTACTGT
TAGGGGCATGGAGGTACTTGCCACCGCCCTAAATTGTAGTGGACGTGCCGGCGAGAAGTGGTAGACAACGTTGGCGATCAGAGAGCAGAGTTACCCCAAC
AGCACCAAGAAGCATTACGAATAGCGCCAAGCATACAACACATACATTTCGTTAGAGTCAATTGCAGCGCCATGGCTCGCGATCATTTCACGCGCCGTAT
GGACTCACATGTACTACTTGTAGTAGCATTAATACAAGTGTACATGTAACTTCCTGCTACATTTATGAGGCTTCGTCAAAAAATTGGCAGGTCCCAGGAG
ATGCGGTAGCTGTCAACAGCAAACTGTCGAAGGCGGAGTGACCGAAATTTTGTAACAAGTAAGTAATCGCAAGTCCCAGTGCCATGCGATAACGGCCACA
AGATCGAGTACATACGGCGAATACGGACGACAAACACCACGGCCAGCACCGTGGCTAGAGCGTACACAACATCGCCGGAATTTGGCACTTCTACCATTTC
ACCTAGTTCGGAAATGAGCAGGCTTGCTGCTTACCTTAATGCAAAACAAAGCCGTCGAATCTGACCACTGGTGAGAAATCGGTCGGATGAGATATATACA
CGCTGGTTACGAAGGCTTCATTGCCATCCTGCGTAAAAAGCCGACCTCTGAAAGTTCCTCATGAGGCGTATTTGATCCCGGCCACAGTCTTGCGGCTGTA
GAGCACGACATTTCGCGACCAGTTAGTCTTGCCCAACTGAGCCTTGTAGCGGAACCGGCCTGCAGCAAGTAGAAATGCATCTATCTTCTCCACGACGTCC
GTGCGCACCTTGATCTCACGGAATGACTGGGGCACGTCGACGCGCATGCGAGTCAATCGCTTCTGCGCGTTGCTATACATCACATTAAAAAAACATAATG
ACAAATTAGCAGCGTGTACAACCTTGCAAAGCATATACCCCATACCCTGTCACCTACCGATAGCATTTCCACGTCTGCGGCTCGATGATAAGATGCTCGG
TCATGTCACTGACCGTCTCGAGGAACTTCCAAAGTCCGTCGTCTCCGTTATTCAAATGAATCCACATCGTCACGCTAAAGCAAGTGATAAGGTCGAACTT
ACGTTCCGCTGGCGCGCGCTGCGCCAGCTCCAAGAAAGGTGCGATTTCCTTGCTAAACTTGTTGGTCATAGCATCAACGTGGCGGAACTGCACTGCATCC
CCCTCTGTTAGCTGCACCGACTTTTTAGCAGCGCGTTCAATCAGCACCTCGTCAATATCCACACCGAGAGCCATAAGCGGCTTTCTCACCGCCAGTTCCT
CTTTCGTTAGTGGAAATTGTTCGGGGACAGACTTTTCACCGGCAGAAATATCCTTTTCGAGTTTCTTGCCGTCCGTAACATCCAATGTGCGCAGAGCAAC
TTCGGCTGCTTTGGCCTTGGCTACTTTTTTCGACACGCCTTCTCCATAACCCATCCTCTTGCCGTCAATCTGCAGCTTGCACACATAGCGTCGGCGGTGA
CTGGTTTCGCCCTGGTCCTGAATCAAGTATTCCACCTGCTTTTTGTCCTTTTGTATGAGTTCATTGAGCGTACTGATGTTGTTGAGGTCAAAATTGGCCA
CATCGTCGATCTGGTTGGCATCGACAAGCGTTGCACGTCCGTTCAATGCGTCGTAGAGGCCGATGGTCAGGTCCCCTTCATTGCAGCCAACGTCCAGCAC
TGTACACGTCGCTTCGCTCATAGCATCAGCTGATTTCTTCACGAGCAGCGTGCGTCTCAGGGCATTGGCCGTCTGGACGTCCATGAATCGCAAGCGCTCG
TGTACCGGGTTGAAGCTGTAGTACGCATGGAAGTTGCCCAGCACGTGTCCTTCGGCCATATTGGCGTTGTTGGTCGAGTGTATGATTGGCATCACCGCAA
TACCGATTGGCTGAAAAAGAGAAGCACACATGACTATTGGTCGTTTTATAAAAGCTCCTCTGTTTTTAGAGTTGGAGAATGCTAGGGCGACAAGTGCTGC
GTACTGTGCCGCGTTTATCGGCGAGCTCGAGACGCTTCACGGCATCTGTGTCGCAGACCAAGCCCGAAGGTTCAAGCGGTAGTGAAAGCAATTTTTCCCG
ATATGCTGGCATGGCATTCTTTGGCGCTGTGGTGCGTTCACACGTTTCGATTGGGGTTCAGAATTATTATTCTGAATTATCGACTCTACTGGTATTGCCT
TTTCGGTGTTAGGCCGTGACGACCGCCTATCTTGGTACATGGCAGGTATGGTATTTGGTATGGTGGCTGTTATAATAGTGCTGAAGGCTCGGTTCTTTCA
TGGATTTGAACTGCAGACCGAGCGCTACTACTGGAAAGTGGATCTGATCAATGAGCGCACAAAGGAGCTGTCTGAGTCTGTTGGAGAGCTGCCTAAGGAC
GCAACAGCAAGCGGTGACATGTGAGATGAATGGAACGCCATTGGCATTGTGTTGAAATTGTTCATTAAACTCACGAGTTCTGGCATTTGGGTCGGTTTGA
GGCAGTGACGACATTGAGTATCGACAGCTTCATCTGGAGGGTAACTTCAAGCATGGAAGCACCTTCTACTTGTGTAAGGAGTCAGGTTCGCTGATGTTGT
GGACTTGATTGGATATTAATCTTACGTTGTGATTGGCTTCGCAGATCCTCGTTCGGCACCTGCGGACCCGAGTGATTCAGTGGCCAGGGTAAAGTCCGGC
GGCTACATTTATTCTCTGTTACAGCGTGAAGATGGGTAGGAAGTTTAATATTTTGGGATGCGTGTGTGTGAATTCAAAGCTCATACTAGCTTGCCACGTT
GAATAGAACATCGGTGATCGTGAACCGAGGTTGGCTACCGCGCAAGCTCCTTGACGTGCACATGGCACGTGATGAGAAGGAGGAAGATGGCAAAATGTCT
TTCGTTGGTGTGCTTCGCCACGGTGAAGTGGTACGTACGGGTATTTTCATTGGCGGACTAAAGTCGCGGTTCTCACGTCATGGATGTAGAAAAACAATTT
TACACCTGACAACGATCCCGAGAATCGCCAATTCTTCTACTTGGACCACGAAGAGATGGCAGATGCCATGGGCGTTACTTCAGCCGATTTGCCTGTCATT
GTTGATGCCCTTGGTAGGTTTAAAGCTGCTCTGAGCCTTTACTCCACACATTTAACGAAATGTGATGTACTCTCAGCGGTTGACGGCGAGACTGGAGAAA
TCGCGCTGGGCAACCCCCTCCGAAAGAATATTGCCTCTTACCTGGAATTCTACATGACTCCTGAGAAGCATGCTGGATACGCCGCGACCTGGTAAGGAAC
TAGTCTGGATCAGATTGTATGCGATACCACCCTGCTCAACCAACGTATGCATAGGTTTGGTTGCAGCATTGCGGCTGCTGTAATGGGTGTACTGCGCTTT
AAGAAGGGAGGCGCCCGCATTCGACGCGCCCCGAGGCTCGAACACCGCTAAAAATGCGAAAATGCAGAGTGACGTGGCTTTCGTCTACAGACATACCAAA
AATACAAACCGGTTAATTTTACCGCTAACTTTCTACGATTTGTCGATAAATAGTACTACTGTAGTACTAGTAATAGTAGCTCCGGCTTCCTGTGTGCATG
CACCGCATTTCCCATAATTATTCAAAATGCAGCACGAGCTTGATGACGAAACCGACACGATGGAGGATGCAGTGCTGTTGCTGCTCATGCTGTTTGTGCT
GGTAGTGGCGTCGTTTGTACTGGACCGTTACTCGTGTATGGTTCTAAGCCAGAGCAGCTTCGCGCTCCTGTTTGGGCTCTTCGTGGGTCTCTTCATGATC
ATGGGAGGCAAGCATGCGGCGCTACACACACACCTGAACCTGGACAACAGTCTTTTCTTCAATGTGTTGATGCCACCGATCATCTATGAAGGAGGCTTCT
CTATCAAGCGACAGGCATTCTTCCGGAACTTCCCGGCTATCATGAGCACGGCAGTTGTTGGCACAGTCATTGCTGCGACTATTACGGGCGGCGTGCTTTA
CCTCGCTGGTGCATCGAAGTTAGTTACGAGACTCTCGTGGGTGGAGGCTCTGCTTTTTGGTACGCTGATTAATGCTGTGGACCCGGTGGCTACGTTATCG
TGCTTTAATAAGCTCCACGTCCCACCGCTCCTGTTCAACCTAGTTTTTGGAGAGAGCGTGATCAACAATGCTGTAGCAATTGCGCTGTACCAGACGCTAC
ACAAGTGGGACGTCGGCACTGATTTGAGCTGGAAGCAATTGCTGCGGGTGGTTGTCAACACAAGTTGGATGTTCTTGGGGTCGCTGCTTGTGAGTGCAGC
GATCACACTTTCAGGTGCCTTCCTGCTCAAGCGCAAGGTTTTCTCGTCGTTACATTTCTTCCCCAGCTACGAGATCTGTCTGTGTTTGATCTTTAGTCTG
CTGACGTATTACGTGGCTGACAGTCTAAAGCTGAGCGGTATCGTTGCGCTGTTCTTCTCAGGAACCATGACCGCTCACTACCATTTCAACGCGTTGTCAC
GTGAAGCTCGACATGCATTTACGCATTTGCTCCACACGATTTCGTTTGTGTGTGAGAACGTTGTGTATGTATTCATGGGCACGTCGGTGATAATGATTTT
CTCCGGTCATCCAGAGAAGAGTTTGGGTGCTGCTCTTCGGGTAGATGATATCGACTGGCACTTCATTGGTCTGACGCTTGTGGCATGCGTAGTGGCTCGC
TTTTTCAACGTCTTCCCACTTCTAAAGCTTTCCAATTGGTCGCGGGAGTCTTCCGACCGTATTCCAATCAAGTACATGAGCGTGATGTGGTTCGTTGCTC
TTCGTGGATCCATCGCATTTGCACTCGCTAAGAACTGGAACTACATTGGTCGCTATGGTTCCCATCGCCACCTCGTAGAATCTACTACTCTCGTGGTGGT
GCTCTTTACCACGATCGTGATCGGTGGTCTTACTGGCCCGCTCCTCTCCAAGCTTCGTCTCACCAACCACCACAGTGCATTGAGGCAATCTGACCCTGAG
CCGAACGCTGATGGAGAACCGAGCTCTGAGGTGGATCGTGCTCGAGTGTTGCAGCGCAGCACTCGTCACTTCATGCTTCGTCGGAATTCCAGGACCCCAG
AAGCGCACACCACGCAAAGGCCTTCAGAGGAAACTACTACGCGAGAGCAAGAGACTGAGGTGGAAGCACACCCCGTGTTCACATCACGACCGCAGTTCCG
AGACGAGGACTACAGTGATGACGAGGGCGAGCGTAACGGAGACTCAACGACTCACCGTACCGAGACTCTGACTGGCGCGTTCATTCGCAATTGGCAGACC
TTTGACACGACTTACATGCAACCAATGTTCGGTGGTCATCGATCCCCTGCAAACCCATTACCAGTCGACGAGGCAACCGATTCGGAGGCTGACAAGATGC
AGACGCCAAGCGCTGTCTGAGATGGAACAACTTCAACCTTCTCGCTTGTTGGTGTAAAACACATATATTATGCATACTGAATTCAGGTGCTTTAATTCAG
CAAATCAGACCAGTTTTGCTGACTAGATGAGCATGTCGCATACCGCGACGGCCAATCGAAGAAGTCAGAGACTAAGAGCCAAAATCCCACCCAAACAAGG
GTTAAAACGTTAGACAAATAATCACCATGGAGGACGCGGTGCTGCTGCTGCTGATGCTGTTCGTGCTGGTGATGGCTTCATACATGCTGGGGCGCTACTC
ATGTATGGTTTTATCTCAGAGTAGTTTCGCGCTCATGTTTGGGCTCTTCGTGGGTCTCTTCATGATCATGGGAGGCAAGCATGCGGCGCTTCACACACAC
CTGAACCTGGACAACAGTCTTTTCTTCAATGTGCTGCTGCCACCGATCATCTACGAAGGAGGTTTCTCGCTCAAATGTGCGGTCTTCTTCCGGAATTTCC
CGGCTATCATGAGCACAGCCGTGCTGGGCACAGTCATCGCCACGACAATTACGGGCGGCGTACTGTACCTCGCAGGCACTGCTGGTATCGTGACCAAACT
GTCGTGGGTGGAGGCCTTCTTATTTGGTACACTGATCAGTGCTGTGGACACGGTGGCAACGCTGAGCTGTTTTGATAAACTCAACGTGCCACCGCTACTG
TTTAACCTCGTATTCGGAGAGAGTGTAATGAACGATGCCGTCGCGATTGCGTTGTACCAGACACTGCACAAGTGGGAACCGGATAGTAACTTCAGTGCCA
AGCAACTGCTTCGTGTGGCGCTAAACACTGGCGGGATGTTTGTGGGGTCTTTGATCGTGAGCACGCTTATTACGCTAGCCGGAGCTTTTCTCCTTAAACG
CAAGTTCTTCGCGACCCTGCGCTACTACCCAAGTTATGAGATCTCGCTGTGTTTGATTTTCAGCTTGCTAACGTACTTCGTGGCGGACAGTTTAAAGCTC
AGTGGTATTGTAGCACTGTTCTTCTCGGGTACCATGACGGCGCACTACCACTTCAACACGTTGTCGAGGGAGGCGCAGCATGCCTTTACGCACCTGCTGC
ATACGTTGGCATTTGTTTGCGAAAATATTGTGTACGTGTTCATGGGTACATCAGTAGTTATGATTTTCGCGGGTCACGGTGAGGAGAATGCCGGTGCTTC
ACTTCGCGTGGACGATATCGATTGGTCTTTCATTGGGCTGACGCTTGTGGCCTGCATAACCGCTCGGTTCTGCAATATTTTTCCGCTTCTAAGTCTCTGC
AACTGGCTGCGGTCTCCGCCGAACCGAATCCCGGTTAAGTTCATGAGTGTCATTTGGATGGCAGGTCTTCGTGGTTCTATGGCCTTCGCTCTGGCCAAGA
ATTGGAATTATGTTGGTCTTCATGGAGCGTCACACCGCCGACTAATTGAGTCCACAACTCTTGTGGTGATCCTGATCACTACAATCGTAATCGGCGGTAT
AATGGGACCGTTGCTTATGAACCTGCATCTCACCGGCAAATACAAAGATCACAGTCACCTCGACCAGTCTGACACTGTTAGGAGCTCTGCAACTGCGTCA
GAGTCTGAGGACACAGTGTCACAGCTAGTTCAGCGCAGCACTCGCCACGCTGATGGTGGTGCCTTAGCGTTCCCGGAGGAAGAACAACCCAAAGAGAATC
GTGATGGTACCGGAGACGAGATCCCGATCCTGACTCCGCGTCCACAGTTTCATGATGTTGAAAGTGACGACGAGGATGATCCGAACCTTGATTCGCCCGT
TGCTGAGAGATCTCGTGGCGATTCATTGACCGGTGCGTTCTTCCGCAACTGGCAAGCTTTTGACACCACCTACATGCAACCAGTTTTTGGCGGGTCTTCA
CAGCGGCCAGCGGCGTCAGCCTCCGTTGATGAACTAACCGAAATGCGGCTCGAAAAAGCTCAAGCAGAAGCGGCCGTATGAATTTAGCGATTTGAAGCCA
TTTTTTAAAGTGAATAGATGCATTTATTATGTTTTAAGGGGTCTGGTGCCGTGGGGATGCCATGCTGCAATACCTTCTGTTATTCCGAGTGTCGGAGCGA
TGGCGGACGGAATCGATGCCGAGACTGGCGCTGCAGCGGCTGCTCCAGGTATACAGACGCAACCGAGTGAAGCTTCACAACTTACTGCACCGTGTAGTGA
GCCATTCGTGATCGTTGCCACTTCAGATATGCCCCCAGCCGAGAGCGATGAGGAGGCCGACGAAATGGTCGATACGCTGGAGGACTTGATCTTGGAGGCC
TATAACAACATGCAGATTGACGGAGAGTATATTTTCCTACCGGGCGATGTGGCAGAAAAGCTTCATCGAGTTGCCGAGCAGGTGTGTATCACCGAGCGAT
GCATTGTGTTGATTTGCTGACTGTTCTTTCATCTAGATGAAGATCCAGGAGAGTGGCGAGGAGGAGCACACAGTGAGCAACTCAAGTGCAGGCGAGGATA
GCAGCAGCGGGGATGCTACTGCTCGCATGGCTGAGTTGGTGGAGGAAAAGATGCCACAGCTGGAAACCACTACAGATTGGCCAGAACCTGAACAGGAAAA
GGAACAGGAACACGAACACGAACCAGATCAGGAAATGGAAAAGCTTGATATACAGGAACAGCATATGGGCGAGTGTGAGGAGGCAAGGTTACGCAAGGTG
CACGCGTTGCAGATAGAGGCGGCTAAATTACGCGAAGAGAAGCACAAGCGACAGATTCCTCGAGCGGAATCCTCGGAGAATATCTTTACGGAGCTCGCCC
CAGTGCCGGAAATAGATGAAAGCGCTTCGAGTGGACCGCCGTCACCTTCGCCACCGCATTCTCGCTCGCACAGTGGTTCAAATACGCCAAAGCCGAGGCC
AAACACACCAGCTAGAGGGCACGGACACTTCCCCCCACCCCCGCTCATTTCGTTAAGCTCTACACCGAGTAGCGTCGCTGCGAGCCCAGACCAAACAGGG
AAATCACCAGCATCCAGAGCGGACCAGTCAGGTGATAGCAAAAGTAAGGGCAAAGTCGAAACTTATGAAAAAAGGAGGGAGGCTGCGCTCAAGCTGAAAG
AAGACAAAAAGAAGCGGGAGCTACGCATTCGTGAATCTGCGCGAAAACAGCGCGAAAACTCAAAGCGGCAGCTGGAAAAAGTACATCAGCGAGAGATGGA
GGAAAAGCGTGAGCGTGTTCGCCGTATCCGAGAAGAGAGGATTCACCGGCGTTCGGAGACAGCTGCCGGTACTAAAGGGGCAAAAAAGGAGGGGTAATTG
AGTGTTTATAATGATGTTCATACTGCTCGTTCAGTGGCAAACTGGGCCATGATGCTAGGCTTCGGCATCTTTAATGTCCTCCCCGTTCAAGCTGCGTTCG
GCTTGTAGTCGAGCTAACGTTTGTGGATCCAATTCCTCGAGTAGCGCGTGCATTCCATCCAGCGAGCAGCTTAAGACTTCAGTCTCACGTCGCAGCTTTG
CCTTCCGCTCTTTGAGGAGTTTCTGACGATGCTCACTTCGGCTTGATTTGTGCTTGAGATTGAGGCTTCGTCTCTGTAATTTGCTGCCAATGACCATAAG
GAAACGATTGAGGAAGGATCAGTTCGATTTTACCACACGTACAGCACTTCGAAGTACTACGGGTCATTACTTACCTTGAATAGCGATTTAGCTCGTCAAC
GCAGTAGCTTGCATACTGGCACGAGAGCTGCAGCAGAACCAGTGCTTTCGTCATCCCGTCTTTAGGTTCTTCCGACGTAGCAGTACTGGAGCGTTGATGT
CTAGTACTGGTGCGACCGTATAGCGTTAAAGGCACCAAGTCGCGCAGAGTGTCGGTACGGAGCTGTCCCACGATGATAGCTACAACGTTAGAGCAATAAC
TACTGAGTCCACTGACAAACATTTACCTCGTGCACGATTTGTCCGACTCGAGCTGTTCGAAGCTTTCCGCTTCTGGTGATAGAGTGATGGGGGAGAACAA
ACTGAAAAGGTGATTTTTGTGGAGGTGCTGCGTTCGCTATCATGGGTTTTTCTGCGTCCGGGCTCTCAGCCGTTGGGTCTTCAGCACCAGTTATACCCAC
GCAAAGGTGAGTTGACGGGCTTGGCAACTCCGCCTCGCTTTCCCAGTACTTTGGTTGATTCGCCATTATACTTGAGCTATGGCGGCTGTTCTTCTGGATT
TCATACCATCGTTTTGCTGCACCGGACTGAATCCACTGGTCCAAGTCCACACTCCACCCAATGATATACTGCAGGAAATCTGTTGCTTGTGATTCACCCA
CCCAAAGTTCGAGGCTGATAATTCCACTCTTGTGACCTCGTAGATCCACCTGAAGCTCCTTCTTCCAGTTGCCTTTGCCCTTGCGGAGCAAGCACTTGTC
CAACACCAAGTTGCCTTTGTTGCTCCTGCCACTCGAAACAGTAACCCCCTCATTACTCTCAGATCCTGTAGCCTGGATGGGCGCATACGGATCTTCATTA
TCTTGTACTCTGATCCTCAGCCATGGCCAACCATCTTCCTTGCGCCAACACCCGCCGCCCACAACGCTCAGCTGTACCATCGGATAGGTTGGTACATGTA
CAATGTATCTTTAACAGTCGTCGACCATCGAAATCGCACTTAAAAGGGTTTGCGTTCTGGTCCAGCGAAGAAATGGCTTGTATTCGGCCTGTCACGGTAT
TGACTTAACATCCTGAATTCCTACTGTCGATAATGAAACCAAGTCATCAAAGCCCAAAAGCTTCTTCAGACTCTTCACTTCCGTTTTTTTCTTCGTTTTG
GAGGAGTGATGGTAGCGATCCGTGGCAAGAAGGCTAAGGCGACGGCCAAGCCCAAGACAGCCAAGGCTAAGGTGGCTGCCTCCAAGGAGGCCGGGGCCAC
GAACGTCATGCGCCTTACACCTCAGCAGAAGCTTGCGCACCACCGTGAAGAAGAATTTCTGGCACTCGTGCGCTTTGCCTTGCAGAGCAATTTGGCTCGC
GGCGTTACGGAGGCCTCGGGCCAATCCATGAACAGTATCTGCAATGCGCTGCTAACGGTGCTCTGTGCACACGGCAAGGAGAAAACGCTAGCGCCAACGC
AGATCCTGGCCAAGCTGCCGCGCACGGAACGAAAGCGCGTGTGTGGCGCCATCTTCTCGGCGGACGAGATCGCCTACAGCTGCCGCAACTGCCAACTTGA
TACCACGTGCGTTATGTGCAAGGATTGCTTCACACACAGCGACCACGCTGGCCACGACGTGTACTTCCAGAGAACAACCGCAGGCAGCTCCTGTGATTGC
GGAGACGTCCATGTAGGTTTATTGGGATTTTACTATTCAATTGTTTTTATCCTTACTTGTTTTGACCATTTTGTAATTTGTTATATTGCGTAGGCTTGGA
AACAGAGCGGATTCTGTTCAAAACACAAAGGGGCGGAAACGGCCGAGACAGGAGCGAAAAAACACAAGTTGCCTAAGCATATTGGGCAAACGGCGCCTAT
TGTAATCGATGCAGTAGTGGAGCACATCTACCAGGTGTTGCTGGGAACGCACTATGGATTTGAGTTGGCTGAGGCTTTTGAGTTGTTTACAAGAGATATC
CCGCCAAAATTCCTGCCGATTCAGAGTGATACAGATGTGGCGGATGTTACTGAAAGCAGAGCAGGTCTTGGAACGAGTAGAGATAGTTCTGCAGCGGAGT
CGACTCGGTCTACAAGACTTTCGGCACAGTTCACAGCTGATCCTGGATCCAGAGCCATCGGACCTGGCGGCAGGCTCGAGGCACAGACTAACGAAGCTGA
CCACAAGACTACAAGCTCTGAGGACGACTCAAAGGCTGGAGTGCTCTTTGGTATTGGACTGCACAATGACGACGTTCACTCAGTCAACGAAGTGGTCAAT
CATTTGTACGTGGAGTTAGGCATGTCCAAGCCGCAAGCGCGCTCTGCAGTCAGCCAAGTAGATGATCTAGGCGATGCGACTGTGGCAACAAAGTCGCTGC
TGTTGTGTCCTGGCATTGTCGGAAACCTGATGCGTCGGTCTTTAAATATGTCTGTCTCTCCTATGTGGTGGGAGAAACAAATGGAGGGTGTCCCCGCTCT
TCTGGAGTGGCTGCAGTCTGTGAGTACCACATCGGATGGACTCAGCGAGCTCGTGTCTGAAGCTCTTCAGAAACAGCGATCATCTGCTCTTAGAGGGTTT
CTACCGGTATCAGGCAGTTTACCCAAGGGCAAGACGATTCAGCAATTTGTGAAGGAACATAACATTCGACTGCACAATCATGCGTTGGATGTGCTCGTTG
CCTTGATCTCCGGGGACAAGGACGTCTTCACGTGGGCACGAGACGAAGAAGCAGCTCAGCAGCAGCGATTTGATTTTCGTGTTGAAGGCAACACAACTGC
AGTGGCGTCGACCGGGTTCCTCGCTGAAGGGAATCACGTTAGTTGCAAGAACATATTTATTGAGGAGTTTGTCAAAGCAGTGTCGCTGAGTTCCTCGTAT
CGTCGTCACGAGAGTGTCCGGAAAAGTTTTGACGCTGTGGTCGCCAAGTATTTCACGTCGGGGCAAACAACCAATTCGGGCGCCTCGACTAACACGCTGT
CAGCTCTGATGCTTCTAATGCGATACGATTGCACCCTACGGAAGACTGCAGTGGAGAAATCGCACTCCTTTTTGCGCGAACACTTGGTAGATATCCAGTT
TCGTGCTAGCATGCTGGAGGCATATTTGCGATCGTACTCCTCGATGACGAGCATGTTCCTTCGTGGATTGGGCAATTCCAGTGATTCCATTTTCGATTTT
GCCGTGCAGTTTTTAACTGTACCTCATCTGGTGCAAAAGTACACGAAGAAGGAAACCTCTGCTCACCCTGAACGGCTAGAGTTGATTCGGGAATTGCTGT
GTGCTCTTAACACAGTGTTCCAGTCTGCTGTCGATGAAAAGGATGGGAAACTCAACGCTGACCACCCTGCTTTGAGCAGCCAGAAGTACAAGGTAAGCTT
TACTTCTTCAGAGACCTGCATGTACTGTCTTGCTGAACTCTCACATTCAAACCCCTGTCCGTTTTATTTTTGCTGCAGCATTGCGTGGAGAACATGGAAT
ACGTTTTCAATATCGGCACGTTGTCCAACGAACTGGTGTGCAACGCGGACAATATGAAGATTTGGCTGTCATGTTTGGGTATCCTGCAGGTATGTTACAG
AGCTGTTGGCTTTTTGATAGAGCTGTGCCATTAAATATGTTTTCCATGTTATTATTCATAGGGCGGCGATGCTCAAGTGCGACGAGGAATTCATCAAAAT
CACGTGGAATACGAATCAGACAGCTGGTTGTCAATGTTCAATCTCGGCATCCGTGTCCATTCGGTATTCGCGATCTCCTGGAATGGATTTAGCCCGTCCC
AGTTTGAAGCACCGGAAGGGAAAGTAGCGGAGATATTTGGCCCGATTATCGACGCCACTCTTTCATCGTCAGCCCGACTCAATGAAAGGGTGGCGAAAAA
GACGCTGGTTCCAGTGGCAAAGCTTGCGTCTATGGGAAAAAGAGGAGCTGGAGGTCGAGAAAAAAGCATCATGGCGTACGACTTCAATGTAGCGTCTCAA
CCAACCTCTCTGCACATCCCTCTGCACCGCTTCCTGACCGCGGCAGTGCGGCATATTTGCATTAGCCAGGCAGGTTTAGGAAGCTCAATTCCCTCGGACG
GCCTTTTGAAGGTGTTTGGCTTTGACAAATTGTCGGCTGACAAGAAATGGGAACTTGTGGAAATGCCCCTTCGCTGTTTAGTGATGGCATCCCAGATCCA
CTCGAATTTGTGGCGCAGAAACGGAGATGAAAACATGCTGGCGCAACTGTACAATTACTCGGCGTTGCCGTACTGCATTCACTACCGTGACGCTGACACG
CTGATGCTGCAGCTCGGTGTCCTCATGACTGGTCCGGATGCCCTTGTGGCTCGTATGGTTGATCGATTCCAGTTGGGCAGCTATTTCATTCTACCCAATG
GGTCCAACATGAATGGCCCAGACGATTTGGTGAAGGAGTTCGGGTATGCAGAGCTAGAACAAGGAATCGATGAGCAACAACGTCTTCAAATGCTGGAAGA
ATTTCTGCGTCTCGTGATTATTCTTGGTACAAGTCTCCCAAGCGCTACTGGATCGACCTACGACAATGAATTTCTGGCGGAAGAGATGTTGCAGCAGTTA
TGCTCAAAGTCACAGTGTTTTAGCAAGCTGTTTGACCTTGCTATCCTGCCGTCAGGTCAAGACGACATTCCAACTGCACGGCTACAAAGCGTTCTTGCAA
AGGTGTCCAACTTTGTGCCACCGTCGGGACTGGAACCTGGCCGATACGAATTGAAGGAGGGTCTTCTGGAGAGCTACAACCCGTACTTCCTCCATCTGAA
CCGCGAAGCACATGAGCTAGCACGTGATCGTTGGACGACCTATCGCAATGCATATCGTCAAAAGGCGAAGAAAGCAAGCCCAGATGCGCCTCCGAAGGAA
CCGCTGAAGCCTGCGAAACCTCCCGTTGCCTTCCTTCGTCCAGCCCAAGCGATTCTGACGTGTGAAAGTACTATGGCGATTGCGCAGGTTATTCTGTGGA
GGGTCATTTCCTCAGCGCACACTGGATCTGCACCCGCAAAAGGCTCGGAGAACAGCGTCTCTGATGCTGTAATCTCGACCTGTTTGCACTTGCTGGTGCA
TGGTGCGCACACGGCGTCGCAGTCTTCAGACCGCCGTTTCTGGACGCGCTTAAGCAAACTGAGCGCTGCTACCTCCAAGTTGTCGGTGCTTCATCTGTTG
AGTCAATTGCTCGAACAAGCAACCACGCTGCTCGATAACGAACAAACTGGAACGGTCGAATGGCTCATTTGGAAGTTCAGTTCAGAGTCTCCTGCTTGCA
GAAAAGTATTCGAGCAATTGTCAAATGACGCCACGTCGAAGCAAAAGAAGAGCGAATCATCACCTGCGGCTACAAGTGGCTCGACACTGAGCGGTAATTC
TCCGCCCATGACGTTGGAGCAACGCAAGATGGAGGCTAGGAAGAGAGCGATGGCTGCGATGGCAAAACGTCAGGCTGCTTTCCAGGCGATGGTTGATCTT
GAGGATGATGGCGAGGAAGAGAAGATGGATAAAGAAGGGTCAAAGGGAGAGCGTTTGGCGTTGGGTAAGCGCAAGGCTTCGATGCTGGAAGAGCCTGAAG
AGGATACGAAAAAGCACCAGAAAGTGGAGAACAAGCGGTGCTACAACTGCATTCTCTGCCATGACAGCTCGCAACAGGGTCAAATGGGAATGGCGGCCTA
CGTCCATCAGTCTACTGTTCTAGCTCCAGGATTCAGACCCGAGCCTAACGAAGCTCTCGGTCCAGAGGGGAAGAAGGTTCGTAGTCACGTGAAGAAGGTT
ATCGAGAAGATGGAATTGTGTTCAGGTGGCAGCTCGACCTCGTCCGATATGCCAAACTCCCCGTCGCCTACTCTGCGTGCTTTCGCGACATCGTTCCCGG
AATGGTACATGGATGGCTCACTGGAGGACCAACTTACTCGTAACAACACGGCACAGAATAGTCCTCGTCCGTCTGCTGCTCGTCGCCCTCGCAATGATCG
CATTCGCTTTGGCAATGGAAATATCCCGATGCTTGAAGGCGAGCTATTGCAGACAGATGAAGAGCTAGAGGTTCTTGAAGGCGTTCTCGACCTTCGTGAA
GATCAGCAGCTCTTTCCGATGGATATGCGTGGCGCTGTGAGCTTAGACTTGCGCGGTAATCGAGTAGAGCCTCGTCGATTGGGTGGGCGTGAAATGGTTG
GAGCCAGAGGTGGCAACATGCGTGCTCAAGGCAGACCGATGTATGACAGCGATGATGAAGACTTTGAAGATCGATTCCATTTAGAGCGTCTGCCGCCCGG
GTTTGGTCGACCTCACGAGAGTGCCAAGCTCTATCTCACTCCGTGTGGACTGCACGTTCGTACATGCCAACATGCCGTGCACGTCAACTGTCTAGAACGG
TATATCACGTCACTGCATAACAAGGCAATGCGCGGTGAAGAGTTCGATGGCGTTCAAGCTATTGATCCGGATTCAGCGATGACACAGTTCCTGTGTCCGC
TGTGCAAAACGTTGAGCAATTTCTTGATCCCAACGTCTGAGCCACGGATCTCGATAGGGAAGGAAGACGAACGGGAGCAGAAGCGTCCTGCTGTGGCGCT
GACAGGAGATGAGGAAGAAAAATCTCCTGTCTGGGACAAGATCGTGGAAGACCAGTTGTCGATGCCCGGCTGGTACCGCTCCGTACTGGGACGCGATGGG
GGATTTGAAGACGATGAGAACGACACAGAACATGATATGTGGCGAGATTACTTTGAGGATACGTTATGGGAGCCTCATGGGAGTCTGGAAAAGGGCGCTC
CTTTCTTGTGGGCTTCGTGCGCGTATACTTTGGCGTCATTTTTGACTGTTGCTGAAGATGAACACCAGAGTATCTCCAGCAGCAACGTACCGTTCGATCC
GCTAACAGACCAATGCCCTCCGTCTCTTGAGAAGGAGCTAGAGTCGTTAACATCTGTGACGAAGTTCTGTCGATGGACATGTTCACTCTTGGAGCACTGT
GCCGATGCCAAGGTGATTTGGGAGGCTGCTAAACGCTGTTGCCCGATCAATACCGAGACCAAGCGTGAATACCGCAAATTCACAAAGGTAAGAAACTTGA
CATCGTGGGCTTAATGCCATGCTTTGAGGGAGTATACCTGATGCTAACTTGTTTTCTCTTTGATTAGGTGCTTGGCTCGATCGATGCTTGCCTTCGGGGT
ACCATCTTAGGTCTGCTAGTAGCGGATACATTCACGGTACATTGAAATCTCACCTACATAATCGATATGCTGTCGATAACTAATGGAATTGAGCTGTGTT
GCTGTAGGCTTTCGTGGTGGCCAGCGTGATAGCAGATGAACTTGAAACAATTTGGCGGTTCATGCCTGTGTTTACTGCTGCGGACTTATTGCAGCGTCTG
CATGCTGAGTTTTTCGAGCCTACTAAGATGGAGGGAACATCGCTATTTCAAGATAAGTTCTCGCTTGTTGCTGCCAGTGAAAGCGGGGACTCCGGACAGC
CAGCAGCAGTGGAGGGAAACGTCACGGCGTTAGATCCACGCCGCACAAGAAGTGGCCGTGCCATTAGCCCGATAGAGCCAACTCGGTCGTCTAATGCTAA
TGGTTCTGCTCAGCAGCTGATGGAAGTGATGGAGGTATCTGGCGAAGCGGAGTCTGACGCGTATGCCGCGCTTCAGTTGTTGCAGCGAATGGCGAAGGCG
CACCCAACTGAGAAACTCAAGCCATTCACAACAGTAGCAGATGTTAAGGCACGCCTGCAACGTATCCTACCGGCCAATGCTTCGTTTGTTCGCCGTATGA
AGCTCTTCTGGCGCTGCCTGGTGGATGGAGAAAGCAGTTTTTCAGCTACAAGCAGAACGATGCAAATCCCCACGTTAGTCGACATAGCTCACTGTTCAGA
CGCGACGTTCGATCAAATCTGGCACTGGTGCATGGATCGCATGCTCAGCAAGACCCACCTGGGCAGCTCAAAGGTTGGCGACAAGTGTGAACACACGGAA
GGTTGCAGCGAGGCCTATGTCGCCAGCATGTTTATCCTGCGCGAGGTTCCCACTCGTCCACGTCTGATCGACTTGCCGGTTCAGTACGATGAATTGTACA
GCGAGATGGCAGGCCGCAAGTGCACGCGATGTGAGAAGGCACCTTGCGACCCAGGTCTGTGTTTGATTTGTGGTGAGTATCTGTGCTGTGGAGACTCGTG
CTGTACACGTGCGTTCATGCCTCATGGGCCACCAGTGGGAGAATGCACTCGTCACGCCGCTGAGTGTGGAGGCGGTGTAGGCATTGTTCTGTTGCTAGAA
CAGTGTCGTATTGCGATTGTTGGAGGCAGCATGGCAGCGTACTTCCCCAGTCCGTACGTTGATGCTCATGGTGAAGAAGACATTGGGCTTCAGCGTGGAC
GCCCGCTTCGATTAGACATGAGTCGCTACAGGTACCTGGAGTCGCTGTGGCTCAACCACCGTATCTTCACCGAAGTATCACGTCAACGCAATCAGCGAGA
CCCACAGTATACGATCAACTTGTCGTATCTGTAGGCCTCCCGCCCAAGCACATAGATCACATTTCCAGGCAAACAGCTAACGTTAGTTCAACGTGATCCT
CGAGTTATAAAACTTCATCTAATTGTATCAAGGGCGTATCCTGTTGATGTTGATATGTACTGTACAGGCAGCTAGCTACCCAAGGAATGTGAGGTGTGCA
GGCAAGTCGGCGTCGGCGTAGCGCTCGTCCTGGAAAAACATGCGAAGCAGACGACAATGGCCACCGACACGCACCTTTGTTGTGGTCACATGACGAGTAC
CGAACGCTTGGCTCGTGAGATCTTGTAGATCCATGCACAGGTAGCGCCAACCAGGTTGTGGGCCGAATGCGAGCGGCAACTGACATCTCGAGTCTTCGAC
ACGAGCGAGAGATCTCGTGTTGGTTACTGTGAACCGTCGATACTTTTGTGCATCATCCAGCACCTCGACGTGAAAGTCCAGAAAGAGATCCATGTTCTCG
ACAAACAGGACGAGGTAGCGGAAGATGTTGCGGACGGGAAACACCAACTCGGCGTCGTTGCCAAGAATCTGCACCACGTCTTCCTTGACGGTCTCGTCCT
CCAGCACGCAAACATCGTTGCCACTCATGAGGACCCGACATTCTTCTCGAGCTTGTAAAATCGCTGGGTGCTCTCCAAGTGGCAGCACAACTGTCTCGGT
CAGGAAACTCGTGTTGCTACCCAAGCTGCTTTTCTTCGATCCTTTCGATCTGTCGCCTGGTTCAGAGAGGTGATCCCTGGAGATAACTTTAGGGAGGATG
CACTCCACATACACGTCTCCAGGCGAGAACGACCCCTCTCCGATGCGAACGAAAGATGGCACGCCGGACAACGAAGATGAAAGTGTCGGTGGAGTAGACA
AGGAGCTAGCGGTCTTCATCCTAATCTTTTTGAGCGAACTGACCGACTCTTCACCTCCCAAAAGTATCAATAGGTCACTCGCAGTTTCCCCCTACTTGCT
TCTGCCCCGTTAGCAACAAAATGGAGAACTCAGCTGCCCAAACGTTCTTCCAAGCACACAAGAATCTCTTCCAGTACGAAAAGCATGTCGGTAAACAGGA
CCCTTTCCAGACCGAAAACACGAAATCCTACCTCTTAAAATATCAAGAAATTGACCGTGAAAAAGAATTCGCTCCAGCTCTTTCGGAGTTGCGCTTTACA
GCGCTCCATCCTCCGATACGCAACTCTCCATCAACAAAATTCTCAACTTACACAGCCACTCCAGTACCAGAATTCGTCACGCTGGAGGCGACAGCATCTG
TCCTCGAAAACTTAAGCAGGCTTCAGCAAGAACCGGTCCACTCCCACCCATTTGTAAGCCCGCAGCAACAAACCACCCAATACACCCAGCCACAACCTGC
TTATCGAGTCACGTACGACAGCCCAGCCACACCCCAATACCCCAGTCCTGACCGTATTTCCGTCTTCAAGGGTACGTCGGATCGATCCGCCCTGCTTCAA
CAACGTTCGCCTGTTCGGAATTCTGTCGAGTCGAAGCAGAAAATCTTCACCCTACCGAAGCTATCGGAGCTGTTGATTGACCAAGAAACTCGTGCTGCCA
CTCCACACAAACCCTGGGACGAATCGCGTAAAATCCAAGTCCTCGTCGGAAGCAACTGTGTCGGACGTGTGAACGCTGCGTCTCGGAATCTCCCGCCATC
CATCCGCTCCCGCTTGCGAGCGTCTGCAAACGTGTCAGCACGACGAGAGCGGTTATACGACCTGCTTCGGCGAGATTATGAGAAGCTCAGCACGTAAACG
ACGCACCGACAAGCGGCGACTTGGAACACTTCGACAGAAGCTGAGAGGAGGTTGGTCATTGCATTGGAAAGAAGGCATCATCTGTCAGCCCTTCGAAGAT
ATTTACGTTGCTGTCCCCGTATAATGCTGAGTCTGGAGACATGCTCATGGACCCCACTCCACTCTGCTGTTGGAGCTGATTTTGTTGCTGGAAAGACTGA
GGCGTGGGCTGGAACTGCTGTGTCGGTAATGGCTGTGGCATCATATTTGGTGCTGCCCCATATCCAAAATTGTTGGGCATCATCGACGCTCCTTGTGCTC
CGAAGTTGACCGCGTTCATAGACCCCATCATCTGCTGTTGCTGCATGGGCATGTTTGACATCCCAGTCATGGGGAATCCCGTTGATCCGAAGCTTGCATC
GGGGCCGAACCCAAGTGGCGTCATAAACGGATCCACGGGAAAGTTGTTACTGCTACTATTGTTGTTGCCATTGACGTTGTTCGCTGATGTCGATGCTGAA
GACATGCCGTAATTGTTGTTGTCGTACATATTCCCAGAAGACGCCAAGTTCATGGGCATGGGCATGGGCATAAACTGCTGTTGTTGCGGATTCATCATGC
CGCCGCCCATCATGTAGTTTTGCTGGTTCATAAATGCAGCAGACGAGCTCGGGGGTCCACTCGTGGAGGTCATGTACGCGTTGGGCGTGAACGTCTGTAC
CCCGGAGCTCATCGCGTATCCTTGTGTCGACGTTGTGACACCAGAGACAGCCATCGAAGAGCTTGAAGTGAAGCTAGTCGACGTCTGCATGGGGTTCATC
TGGCCTGTTGGGAAGAACATACTCGAGCTTGTCGACGCGAAGCCAACTGTCGGCATCGGAGGCTCCGGGAACATCGTTGGAGGCGTCGGTGCCCCCATAT
TTGGCATCGCCATGGACGCTGAAGTGGACGAGGTCATGGCCATCGGATTACTGTTAGCCCTCATCGGTGGGGGTGCATAAACCTGCTGCGGAGCAGGCTT
CGGCTGTTGTGGAATCTGTGGGACTGCAGAGCTCGGAGCTGCCAGTGTTGGGTTCTGTGTCACTCCAGCTTGTCTTGCTGCTGCTGCATTGGGCGATATC
CGCCGCCCTCCACCCTTCTCGTCTTCGTGAGCGATCTGTTTATCTGCCAATGAGGCTAACAGCTCGAGCCTAGCACCAATTTGTTGACGAAAGATCAGAC
ACCTCCTCACCCACTCCTTGTGCTCTGCAGGGTTTGTCTTGGCAGCTACAGTACCAATTACAGCCATAATATGTTAGTTTCAAAATGATTCATATTACAT
CAAATGACGACAAAAGAGTATTCCGGGGCTCGTACGCTGCTGCTTATGGAGCGCATTCCAGCCTTTAAGCGCTGCCTCATTCTTCTCAAGCATAGCCTGT
ATCTCTCGCTGCGAGACGGAGCGTCCCGGGGCCAGTAGCGCCTGCGAAAGGCCACCACAGTTAGGAATACAGGCTAAAAAACAAAACGTTTTCGTTGACA
TTCCACAGTGGATATTCTGCTTTTTAAAACGCACCTGCGCCGCAGCGGCCGCGCGTTGCTGCAGTGGGTTAGCATGCTCCCTGTTGGACGCAAGAGACGC
ATGGAGAGCGTGAGAGGCTGACGCTGGATGGACGGTAGAGGCGGGCGGAGTCACGTACGGCGCCGAGGACGACGCCATGGCCGATAAAGGCGGCGGTGTG
GGTAGTCTAAATAGCGAAAAATAGCATGGAATTGAGGGTAAGAATTATCAATCAAAATGCAACTAATCAAATGATTTTACTTAAGTGAAAGCCAATGAGA
AGCGAAGCCTAGCCCTTTTGCTTTAGAAAAAGCACCTGGCGAAACACCATGGCGAATCTCCGCCCCACCTGTGTGTCTGCACCTGGCAAAGTACTGCTTG
TGGGAGGGTATGTGGTGCTGGATGAGCAGTATTCGGGGGTAGTTCTCTCCGGTACGGCAAGATTTTACTCCCAAGTGGAGACCAAGGTACAATTTCGACA
GGTGGAAAATGTGTCATTTTTTGTCGAGCTCTAACGTCATTTAGCAGATTCTGAATGACAAGGACGCAGTTTCTGCTTCTTCAAGTGAATGGCATCAGCT
ATTCCCATTGACATTGGAGAGTAAACAGTTCGACCAGCGAATTGACGGTTGGATCGAGGAAAATGACGCCAGACGATTCCGTTTTCAGCTCAGGTGACGA
GAAACAGAATCGTGGTGAATTGTGTGGAGATAATTGACTGTGGTTTGTTCCAAGGGAGACTTCACATCGCAACTCATACATTGAGGAGACAGTTCTATGT
GCGCTGAATGGCATTGCCGGATTGCAGGCGCTCAAAAGCAATGATACTTTTCAGCATCTAAAGGAGACGAATGCCGGTGTTCATGTTACGCTTCGCGGTG
ATAACGACTTCTACTCGCAAGTGCAGAGGGTAAGAAGGAGCTTATTGCTATTATAGCTGTAAGGTTTGGTGGTGATGACGCTGATTTGCTTGTTAGTTAC
AAGATGCCAAGTTACCACTGCGTCGTGCCCACTTGAAGACACTCGAGGCATTCCTCCCTCCCACCATGGAAGGTATGCATGGGCTTGATCTACCTACAGA
TGTGAAATATGTGAAAAAGATAGTCTAATCTTAGTGTTTAGAGCGTGGTGGCAAGCAGGTTGCTCTGAAGACTGGCATGGGAAGTTCCGCAGCGCTTGTG
ACGTCGCTCGTTGCAGCTCTCGTGGCATTCTTTGTGCCATCTATGAAGTTCGATGAGGAACAACAGGACCTCGAAGTTGTACACAACCTTGCCCAACTGA
GCCACTGCTACGTGCAGCGCAAGGTAATGTCATCCGGATCATATTTTAGCAACGATGGTCACGTAACAGGTTATTCCACTCCTTATCTTGACAGATAGGA
AGTGGCTTTGATGTCTCGGCGGCATGTTTCGGCTCGCAGCGGTATACGAGATTCCCGTCGTCCATTTTGAACGCATTCGCGTCTGAAGATGCGATGAAAC
CGGAAGAAATTGCCCAGTGCATTACTAACCGCACCTTGTGGAAAACTTCTAGCCGCGTGGTAAAATATTGCTGGATGTTGGTGCAGAGTTTTGGCCATTT
TAACTCACTTTGTTGCACTGCATTTTCTGGTTGGTAGAAACCCGTTCGACTGCCTTCAAGCTTCCACTTAATGATGGGAGACGTATCTTCTGGTTCGGCT
ACCGTATCAATGGTTCGACAAGTGTTGAAGTGGCAAAGGGAGCAACCTGAAGACGCAAAGCGAGTGATGGATGAAATTCACGGTCACAATTTGGAAGTCG
AGCGAGGCTTTGCTGAAATCTGCGAGCTGGAAGCCGCCTGCAACAATCCCATAGATTGGGAAGCCATGGCAACTCAAAGCCGCGAGCAGGTATACTGTAC
TCCTGTCAACCCGATGTTCCTTCATATGCTCACCCTGTGTGTGTAGTGGAGTGCTATTGATGCTAGGATTGGGGCCATTCTTTTGAGACTCAGTGAAGCC
TTCTCTCATTTTCGAGTCCTCATGCGGTAAGCATGTTTTACTCGTTGTCGAGTTTAATCTGATGACACTCGGACTCATTTCCTTTTCACTTTTTATCTTA
GCGAAATGGGAATTTCTGCCGGAGTCCCAATCGAGCCACCCCAGCAAACTGCCATTCTCGACGCAACGCTGGCGATCCCTGGTGTTTTACTCGCTGGAGT
CCCTGGAGGTACGCGCTCATGAAGCATTTGTATCGTCCAGTTGATTAACTTGTCGCTGATGCTTTTAGCGGGTGGGTACGACGCGATTTGTGTGGTGGTG
CTGCATGAGCGAGTTCTCAGCGCAGTTGAAGATTTGTGGGTCCAATGGCCTACAACTCATCCCGACTCCACGTACGTATTTCAGACTATTCGCTTGCGTT
TATTACTTCTGACCTGGTGTGGTTGTATTTGTTGCTATAACCCAGTATCTGCCCGTTGCTATGCGACATCGACCGTGGCTTAGCTGGGGCTTCGTCTGTA
AAGTCAGGGCTTCAACTCCACCCTGTTGAGTAGTTTATATCCGCTTAATGTGACATTGATGCATGGAGTTTCCTAGACTAATACTTGACTTTAGTGCAGA
TCGTCAGTAAATGTTTGTAAGGGAGCGCTAGATAAACGGAATCTAAGCTCCTGTCAGGGGCTGACTCCCAAGTCGAATATGTCGAAGCGCAAATTCCTTG
CCGATGACGATACTGAGGGGAATACGCACGTAAAGGTGTCGCGTGACACCAAACAGGCTGGTCGAGTAAAACCTTCGGAGCAAGTACAGAATGGACATTA
CTCCATTCCTGGACTCCGGTATGCGACCGAGTCGTGGGCTGGCATGAAGACTAGCAACGAGGATCGTCACATATCTTCCACTGAGCTCTTCCCTGGACCA
GTGTTTGGCGTTTTTGATGGTCACGGCGGAACTTTTACAGCAGATTTCTTAACGCGGCATCTTGTGAAAACTGTCGCCTCTGTAGTACGCCACCGCATTG
GGGGTAGAGCGTTCACTGTCCTGGAACGCTCCCAAGAGCAATCGAAGCAAGAGGAATCTGGCAAGGAGGCTATCATGGAGCAAATACAGCTACTGCGTCA
ACAGCTCGCTGAGCTGGAGTCTTTGAAAGACCCAGATTCGGAGAGCTCTGCTGATGAGATGCAAGTTTTGGTCGACCAACTTACGGATACCATCTCGCAG
TTGGACAGCGAAGTATCGCAAGTTAACGCTGAGCAAGCAATACGCCGAGAAGATCGAAGAAAATGGTATCATGAACAGCACGGACATTTCTTGAAATCTT
TCAAAGAAGCTTTTGATCGAGTGGATTCCCAAATCTTGCAGAAGAATTCGTCGCAAGATGGTTCTACCGCTCTCCTGGTTTGGTTTTTAGCTGACACAAT
CCGGTTTGACGGCGAAGACGACAATGGGTCACTAAGGGACGAGTTGAGCTTGTACACGGTGAACGTTGGCGACTGCCGTGCGGTCATGTGTCGTGGTGGC
CGCGGTGTAGCTCTGACAAGTGACCACAAACCGGATCGCCCCGACGAACAGCAGCGAATCGAGAAAGCGGGTGGCTTCGTGGGCAAGATAGCAGGCATAT
TTCGAGTCTACTCTGCTGCTGGTGCTGGGTTGGCTGTGGAGCGTGAGAAGTCGACGTATTTGGCAGTGTCACGTGCATTTGGCGACCGATCCCTGAAGAC
TCCGACATCGCTTGTTTCATGTGAGCCAGAGGTGAAGCGAGTAACAGTGCAAGATGACGATCTGTTCCTTGTCTTAGCCTGCGATGGCGTCTGGGACGTG
CTTAGCGAGCAAGAAGCGGTGAATATAGCATTGCCACACTTTCACGATGCTAAAGCCGCGGCTGATGCGATCGTCAAGGCAGCCTACAAGAAAGGAAGCG
TTGACAACCTCACAGCTACAGTCATTCAGTTCGGCTGGAAGCCCCATGAACGACTACGCTCTGTTCTCAAAAGCAGTAAGGCGAGTGCTTCTACAAAGAG
AAATGACGAAGCAGAGAAGGAAGAGGAGATTGACATGTTCAATCTTTAGTCCTACTCTCAAGTTTAGAGCCGTAGTTAAGAGTCTTAAGAGTCTTAACTA
CGGCGCGGTTGAGTTCCGTGATTCTTAGATAGGTTGATATCCTTGTTCGTATGAGGCGATGAGGTTCCGTTGTTGAAGAGTCTACATAACAACAATGATT
GTCGTTAAGCCGTGCGGATACGATACCAAGCAACGACAGGAACGAAAAAAAAACACCTCAGCAATCGACGTCATCGCATCGGCATCATACACTCGGAAGC
GCACAGGCGGTATATGCCGTCGATCTCTTCGCTTGTGTTTTCGTTGATTAAGTGCATATTGCTGGTCCACGAACACTTCAGCTTCTGCTCAAAGCTGCAG
ATCAAAACCACCTAAGAAAACATCAACAGGCAGCGCCGTACCCACGTGTGGGATGGCGAACCCAGCGTTCACTATCATCGCATGCAGTTTGGTCGCTGAA
TGCGGCGGCGGGGCGATGCGTAGCACGCGGTACTTGGTGTTCAAGTGCTGGTGCAGGAAGCCTACAACGGTTTCAAACTGCGAAAGGTGTGGCGTCAGAG
GACGTCGGATTCAAAGGATCAGTAGCTAGTCAACGCACGTCTTGCTCAATATTCGCCCCACGCCGTCCGCGCTCGCCCTCCAGTCGCGAGAGGCGATACG
TGGCGAACAGGATGGCGACGAGAATAACTGCAAAAGGCTGCATGTAAGGAGTCGATATCGAAAGGAACGAGTAAGGTCGGCCTGCGTACCTAGTGCGTGC
TTCCTCAGCGAGTCCAGCATGAAATCAAATAGTGACCGTGGCTCTGTTTCAGCGCGCGACGCCCTCAGCTTCTGAGTCAGAAGATTGCTGCTTGAGATCT
TCCTGCTGGTGGGACGGCTTTAACAGAACCAGTGCGCGACCCCCGCACGTGGACGC