Description :
From Genome Similarity Track
Location :
Scaffold_21:121709- 124849
Transcript NameFunction/comments
Phyca_LT15347638translation initiation factor IF-2, putative
Phyca_LT1534506642Hypothetical protein

Sequence
3140 bases(100 bases per row)
gtccgctggtggtgtcgttaactccagatccacgaagtccgggggaagcagcaccgggatcatgttctgcgagtccacgaccagttccgcaatatcactg
gttagcaccgattcttcgttcagtccgttctcccccagatccttcagtgcgcggaacaccacgcgcgtcttgacgctcatccgctctgccagatccttga
ccgtaaccgacgtggggatttccacctcctgtgccggcagctccaccctgggtttgcgcttagcctccttgcgttgcagtctctgggatcgacggcgttc
tcgatcttccgagtcgctacgttcctcccagtcaatatctccaaacagatccgcttccgagtcaaagatgctgttctcaaactggaaattcttgagcagg
ttgcgcgttcctttcttgcgtttcgtgttcatcttcatggccttacgaccgatgggtggtccttccatacggtcaccctctccatccgaagggatgccca
gtgccgccagtacagtagacgggtccttatcccccgtgaaaagcttagtcttcttcggtttctgcctcgggtgcttgggttggcgcttggtaaatgccac
gtcctcgtcgtcattgaaatcttcgagtcccaactgagccaatgtgagctccggactctcctctttagcagctccgataccttccaacagatccagagac
gtctcccggggttgaacagtcttgggttccgtcgatggagctaccactggagtttccacgtcttcaaaggcgaagctcagtaggttctggaacttgttcg
tgaacactggcggctcctggtcttctgccttcttaccacggcgctttctgttcttctggtgcttgttattgctgttatggttagatttcggctctgtttt
aactggtgcctctgtctgttgcgctcctttttgcggacggctcttgttgcccttaaactgaccacgcgcgcgcggttttggcgctgacaaaccgccgaat
ccacgtaaacccaacggaagaccagcatgtgcagtctccacgcctgatagcagcagcgcggaacggcgcagcagcttccattggctcgccatcactacct
caagcctatcggagctttatatccgctcagtgactggtgtgctacacactgctatttaacatcttgtaatgattgcaacagttaaatatcagatatgtta
aaaagaggtgatatcaatttcaaacaggttttcactcaacctgtctactttgatgatatcaactgtgaagagtcagttcacaagggtaccggtatactca
agtcaagttttcatacaggaagagcttgtcacgcgtggcggaagggctccatctgttggcgtctgtgaggctcggggggagatgctgagtgtgccgttgg
tgttgttccgaggcggagacaagatctgctgctctaaggaccgagtgaaactggactggctcgggcaattggttgtcggtctgggggctcatttcgcggc
attgggggaactccagagactggcaatggagacttcagtattagatatcaaaggttcgaagcaggaaaagctgatggaacgcagtgggaatgaccaggaa
cgacctgccagcagtccgtgtccgtcctcgtccagtagtgacgaaagcagtagcagtgctagtagccccagttccgattcaagcgacagttcgaacaatt
ccagtgatagtgaagaggaagccccgccaccgcctgttaattccggcaatggaggtggaggcaatggaggagatgacgaaaagaagaaggagggagacgg
taataacagtgattccagcagtagcgacagctcagcagatgaaagtgaccaggaagaggacgacggagtgatgatcgatacggatgatgaaaaggacaaa
gtgaacaatgggatcgacccaacggacgacgacttaagtgacgagagtggtggaagctccgatctggagaactcgtatccaagactaccttcagctccag
tagacacgctgattgcatttcgacagcaagcagcactgaaggagttgcagatgacggagaagctcaagaaggaggttatagaagatgctaagcaacgact
ccaaggccgacagcagtctcagcgctcgaagaagaagaccccgcagtcgaagcgacgacagtcaaagcagagtgacagaatgtccaacggcacgcacctt
gagaggcaccacacgaacggcagcaccggaactgccgatatgaaggaaggtgctgaagatgagtggctggtggattgctcctgtggactgaaagagaaaa
actatgatgatggaacgtcgatgatccagtgcgatagctgctcgcactgggttcatgcgaaatgtgccgacaaacaacccgaagctgtggcccaggagaa
gtttttgtgcttccaatgcagctggatgttcgattgtgtgtgtgatgttcgccaacgacccaaccacgacgatggtcagcggatggtagagtgtgagagc
tgcaaaacatggcagcacacaatgtgtgtggggatccccatgaccgaggagccagcggatgattaccagtgtccccgatgtgttcggaaagctcgtcggc
gtaaatccgcatcgaatggaagtcgaagtcgtgatgatcgacagcgaaagcgacgtcacagtgagcagtcactgcaccgtcgaaaaagcaaagatgcatc
tccggccgttgcagtggatgtgcgatctgcagctcgctctattgagaatttgacaacgccgactcgtgctcacaggagcagtcgcacagagcccaaggaa
tcgccgaagatggagaggaaagctcctctttcgtcccctcctcctgtccctgccgtctcacctccgtcttctcctcctcctcccccgtcaaccccaccac
cacctgctcacgtctccgggtcttcaagacgtaatcgcagtcacagccgctccaagcgaaaaagcgaacgttcatctgcgtctaatagctcatcaaaccg
gaaacgtggacggtcactgggtagtagcccatcgtcttcgaagaaggagcattcagccgacagggaggaggatgattcgccaggagtaaaaccatcgcct
agaggtaaaggactcatgcttcgagggtactctcctgctg