Description :
From Genome Similarity Track
Location :
scaffold_238:1217- 2778
Transcript NameFunction/comments
Pl_107203hypothetical protein PHYSODRAFT_328487
Pl_107204conserved hypothetical protein

Sequence
1561 bases(100 bases per row)
GTTCCTCTTACTTGTTCTGAAACACTTCGGTTTTCAACACGACTACTGTCAACTGAAATCAGTGGAGTTGCTCGTGGGCAAAGCGTAAGGTACGTAGCCT
TTCATCCATTGTGCACTGCCGAGGATGCCACTTACCAATTAGTAGACACCTCTCATGTGCGAATTCATGGCTACATCTTCTGCTCGTTCAAAAATATTCT
TGTTTCATTAAAATTTGGCTACAGTTGTCGCTTACCTGGTTGATTCAAGGTCCAGAGAGGTTGGCAGTATCACGGATGCATGGAACAACGAGTTCGATGT
GCTTGCAAAACACTTGAGACAGTTCCGAATTCTGGGAATCAACCTTCTCATTGTTGAAGTATGCATCGAATATGCGTATATTATTTATGAAATAATTTAG
TTTGTCCCATGCACTATAGACTATACCTAGCTGCGTTCCCACGTTTCGTGTCGGTCATCACTGATTACAAAGAATTGTTTACTCTTTAGTATATGTAGAA
CTCGCAGGCTCAACCAATAACCTTCAACTCTCTCAGACTCCCGTAGAAGATAGTAATGTATTTTACATGTACTGTGAGGTACACCAAGAACTACTTCAGA
AGTATAAACTAGATGGCCTTCTTGAAGGGAGTTGATCATTCTTTGCATTCGTTTGATTGCTTGTCGAGTCTGTATCGCTAGAATTCTTCAGTTTTACGCT
CAGACAGGATGCTTCCTTAAAAACAAACGCAAGTCGTGCCTACCTCAAATGCACTAGCCGTAGTATTTTGAGTATTACGTAGTAGATTCCGTTTCGATAG
GGCATCGTATTCACAATAAATCCTAAGAGGAGTAATCTGTGAAGCTCGGCTATCGTTTTGAAATGTCCAAACCGTTTATTGCTGGTTGTTGGGCTATAGC
TGTCTAGGTGTGTAAATACATATAGGCCGTGTCTGCCAGATGGCTCTTGTGCTCTAATCCTTGTCAGTCGCAAGGGGCTCGAGAACCACACCCCACCGAG
CGTCGGTGGCAGCTCGTACAGCAGCCTCGTAGCTCTTGCTGCGAGGGCGTTTCTGACCATCCATCTGAGCAAAAGTGCTGGGCACACGCTTAGCCTTGGG
GGAAATAGACTTCTTGACCTTCACCACCCTCTTCGTCGGAATACTTTTGACTTGCGAGCCCGGTGCAGCCACAACACCCAGTCTCTCCTGGAGAGAACGC
TTCACAAATGCCAACTCGTTCGCGACCATGGCAGGGATGTGCTGGTGCAGCTTCAGCAAGTTGTCAGACAGCTTCTCCGTCATCGGCATTCCGTGACGGT
GGCAGAAGAGTGCAATGCGAGCTAACTCCTCCGGGTTCATGACGCCAGAGTGTGTTGAATCTCCTTCCTTGTTGATGCGGCGGATAACCTTCGGGTTCTT
AACCTGCACTTGTTTCAACGTAGATGCAACTTGCTTCGTGAGTTCGTCAACAACTGCCTTCTGGAATCCGTGTTCCTGCACGTCGCCCAGAATGATTTGA
CCAGTAGACTTTACAGCAGAGGCGCTTGCAGGTTCAAGACGCTCAAGACGTAGGCAGCTCT