Description :
From Genome Similarity Track
Location :
contig_75:121693- 126740
Transcript NameFunction/comments
g11787.t1hypothetical protein
g11788.t1hypothetical protein

Sequence
5047 bases(100 bases per row)
AGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGAGTTCCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATT
GGTAGTAAACCACACGATCACGACCTTCGTGATCGAGTTGCATCAGTGCGCATCCGATCGCGAAATCGGATGCATCGCACACAACGTGGAATGGGCGATC
TTGGTCGGCCACCGCCAAGCTCGGCCTCAGTCAAGCCCTGCTTGACTGCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTT
TAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACGTTT
GAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCC
CGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGATTTCCC
ATTCACAGCCCGGCTGTGAATGAACACGTCGTCGAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCT
GGGGCGTTCTTCAGCCCCTGCGGCATCACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCCGTGAGAGGGATATCACTCTCACGCATGAGGA
TCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCTAGGTATCGGCGTCTGCGCCGG
TACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGTGCCACCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGAT
TCCCGCACTTGACCTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTGTCCTG
CGGTAACTCCGCAGGAATGTCGGCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCG
AAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTTCACATGTCATCCTCTCGACGTCCGAGA
GGATGCAGATCTGCTCGATGCGTCCATCGTGCAGTTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGG
ATTATTCAGCCTCATCTTCTTGTATTGGAGACCAATACTCGTACGCGTCAAGACACTCAATGTCTCGACGGTCGTCTCCAACTCCTGTGTCTGCCCGGCA
GACACTGCTTGTAGCGTCTCGGTCCCTGACCGAGACTTGCGCAGCTTTTCTCGCTTGCGCCGTTCACTTCTCGTGCGGAGCCCGGCTCCGCGAGTTTCTT
CTTGTCCAGACCCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGGTTTTACCCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCACCGCTTC
GTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGATGCG
TCTTCTTTACCTCTACGCCTAACGGCGGAGTGTCTTTCGACAAATTGTGTGTGTCGACACGACCGCGTCGCCCCGGACGCTTCGAGACCCTCTCGAATCC
GATTGAATCAGGCCCTGCTGATTCGTTTCACATCTTCTTCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTCGGGTGACCGGAGACAGCCGCATTCCGCG
CTGTCTCTGATGGAGGGCCGCATGCACCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGCGCGCGAT
CGTGCACTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCATGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCGAGGACGATAAGCTCG
TCGACGAACTCCTTCTCTTGGTAAGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTC
GAGGTGTTTCCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCACCACAGTCCACTAGAGCACGAAGAGACTTCTC
TCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGTTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCG
TGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTTTAATTTTTTTATTGCCCGTGACGATACCCAGTATCGCC
ACTTCGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCATAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGC
TGCTGGGGACCAGCAGCGGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTTTCACCGGTCGTGGCATCAGCCGTGGGGCGTTCACAT
GCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACCCTCGGAAGAGATAGATCTTCACAGG
CCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATATTCGAGACCAAGTACCGTGCTCTTTGGGCGTAA
GCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTCTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGA
ACTCCTCGTACGTGCTAAAGCACGTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTT
CGACAACGGGTCGACGATACGTCGAGCCGCAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGCTCCCCCTCTCTTCCAACGTAGCTGCTTACG
TGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACAC
CGTGTTGCTCCGTCGGCGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGA
CAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTTTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCG
TATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGTCTGCTTAGACCCACTACTAAGCTTACACGTGTGCGC
ACGTGTATGAGGAAGCGTAGGAGTAATTTACTTAAGTTTAGTATACTTGTATCCGCAAGTATACTGAAACCTAGATAAAGGAACCGAACGATAGCTTTGG
TGCCAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATC
TATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTATC
CCTTAGTGCATGTTGCACTAAGGTAGGAGGTGAACCGAATGTGTAGCCCCGCTACACGCACGCTGAAGCCAAACGAGCTGAACTACGACATCGTCGAGAA
GGAAATCTTAGCACTCTTGCGCGTCTTGAGTGACTGTTTCACGATGCTGGCCGGGAAGACGGTCCGCATCTTAACCCGCCACACGACGATGGCTTGGTTG
TTCCGATCTAAGAGACTGCAGGGACGCCTGTCACAGTGGGCCGCGATCTTGTCGCCATGGAAACTGAACGTTTGCCGATCCTCGATCTAGTGTATGTTGG
TCCGGAGTTGAGACGCCAAAAACAGGATAAACATCAATGCATGACCGTGACTCCGGAAAGTGGTGACCCTCTTTCAGATGAACTTCGTCCTGAACGAGTT
CTATCGGAAGGTGTACGGCCGGAAGTACAAGATCCGGATGTACCTGTTGAGTTCCGATTGGGACCAGGCAAACGATATGGCTGGTGGGAAGACCACTGTT
CAGATGACACGAAGCGGATTGCGATGGTTCACGGAGTGGTAAACAATTGTCGGACAGATATCCTTTTGGATTCCGGAGTGTCAGTAAGCATGGCGATCTT
GCGCGTAGACTCAAACTCAAGCGAAGTTTCTGCAAACAGCTCCGGGTATCTGGACTGGGTGGCGTTCCGACCATCATCACCGCGAGTGCTGAAGTGAAAA
TCACTTTGGGTCCGAGAACTGTGTATGTCTTGGAACTTTGGGTCGCGAACATTGGTGAATGTGTCGACGTGTTGCTTGGAATGAATTTCATGTATTCCGC
TGGAGTGCGACTGTGCGCACGAGAAGGATTGGTGCAACTTCCGGATGAAGAAACTGTGTTGCTATCAGGACGTGGTGCGGATCAGTACCACAGAGGTTTG
GACCTTCCGGTGAGACCGCGTGAAGAGCTTTTCCTGCGCCCAGGTGAACATGCTATCGTCCGGATACATTACGGACAGAGCAATCCACAACGTGATGTGG
TATGAGCTGGTCGAGGAGACCGATGGGTAACCCAGATCATCTATGCT