Description :
From Genome Similarity Track
Location :
Scaffold_328:12165- 15167
Sequence
3002 bases(100 bases per row)
TCACCGGAAGCAATTCTTGTACTGGTGATACCGCCTAAAGAAACCTACGTAGAACGTAGGATGCGTGCGCATATTTCGTGGCAGTTCAATCGTCTATACG
TTGCCTAGGCGGCGCAGCACCCGAAATGGACCGATGAACTTGGGTAGGAACTTGTTACTACCCACGTTAGTCATTATTTGTCAAGGTAGGTTTACCGTAG
ATAGTAGGAATAATTCACCCTTATTGAATAAAGGAACTTTTTTATTCCATTCTTGTTAGCGTTTCGTTTTTGTCGATCTACCGCCTCTGCGATAGAGTCT
TGTACGAAACAGACAACCGTTTCGCGAGCCATTATGAAATCGTCTGCTGACTGTCTGTCTTTAGCTACAGTGCTCTTGGAGTGTACAGAAGTAATATAAT
GTGTTGCCTCAGTGAGTGTGTATTCGGAAACACTAGGCGTGATTCCGATTTGATTAATGTTGTGGTGAGTAAGAGTATCCTCGCTCTTACTTTACTCTTC
TTCACCAAAGTCGATGTGATCGACATCGGCGTCGAACGTGGTGACCGCGTGGTCAGCACGTGACGAGGGAGAACCGGATTGGCGTTCGCTCGAATGAGTT
CCTCCCCACTTAAACTATAGTCACACAATAAAAAGTGTGCGGACGCGGATGGCGTAAGCCATTCACGAAAAACGGCGTGTGCATCATAGACGCGTGGACA
TATTTGTTGATGGTGAATTCCGCTATCCGCAACAATTCGCTCTAATTCGTAAAAGGGTGGACGTACCGTCGAAGTGTCTCTTCGAGGACACGATTGGCGA
GTTCTGTCTGACAATCTGTTTTCATAATGGTCAGATGTTGACATATTCAAGCGCGTTCCTAGTGTTTTGAACACGGAACGCCAGAGCTCAGCTGAGAAAC
GCGGGTTCCGATCGGACACGAGTTCACGAGGATACCCATGAAGGCGAAATACCGTGTCAATAAAGACACGAGCACAAGCCGATGCGTTGTTGTATTCAGG
TACATCAACCAGATGCACCATCTTGCTGAATCAGCCAACGAACACAAGAATACCAGTACTCTTGTGTGCGTCCGCGGGTAATCCGAAGACGAAGTCCATT
GAAACAGATTCCCAGCACTCTGCTGGGACGGGCAGAGACTGCGACAGAGACCTATAGGGAAGGACTAGACTTCACTCGTTGGCAGATCTCATAGACCCGA
AATTACTTGCGTACGAACTGATACCGGCGGGGCCAGTAAAAGTCGAGGCTCACTGTGAAATATGTTTTCTTTCGACCACGTTGTCCACCGACATATGCGT
CGTGGTACTCATACATGATACGTAATCAAAAATCGCCATGATTTTGTTAGATGACACTAGGCGTGTCACCGGCAACAGCTAAATATTGTAGTAAGTCGTT
GCGAACTGTACATCTATCCGTAGAGGATCGATATACTGGCGACAACTGTTTAAGGCTCTTCCCGGATGGTTGCGAGAGATGATGCATCAATCGCACCATC
TCCGGATCTTACACCTTTCATACATCGTCCAATAAGGTGGACGACGGGACACTCGAAGTCAGTACCACGACAGTGGTCGGACCAGTGTTGGGTTGCACAG
CCAGTTTGAAATCGAGCCGGCGCGATAGTGCGTCAGCAGCGACATTAAGTCATCTTGGCTTATACTCGACGTAGAAGTTATACTCTGCGAAGAATGACCA
CCATCTCGCCATCCACTGCAATAGGTGTTGACTGTTTACGACCGTGCGTGAAGCATGGTCCGTAAAAACGAGGGTCTATCGCCTAGCAGATAGAATCTGA
ATTTTGCCAACGCGTACTTCACGGCAAAGAGCTTCTTGTCGTGGACGGGGTAGTTGCGTTTTGTTGGTTACAGCTGGCGTGACTGATAGTAGACGACACG
TTCCGCTTCTTCTTCTTCATCGTACAGCATTATTGCACAGCCGATTGCAAAGTCGCTGACATCACATACCACATGGAATGGCCTGTCTTGGTCCGCAATT
ACTAAAACTGTCGATCGCAACAAAGTTTGCTTGATACCTTTGAAGGAGCGCTGTTAATCGGTACTCCATACCCACTTCTCGTTCTTTTTCAATAAACGAG
ATAGATACACAGTCATATCAGCATAATTTTGCAAATATGCCTCCAGGCCAAAGAATTTCGAAGTCCCTTGATATCTGTAGGCACCGGTGATCGCTTTGAT
ATTTTCTGGATCGGGCAGGACGTCATGCTTATCCACGATGCAAATAAGATATGCTATTTCGCTATCAGCAAATATACACTTCTTTAGGTTGGCGTACAAC
TTATTCTCGCGCATAAGCGTAAGAACCTTCCGGACGTGGAGTCGGTGCACTTCCACATCCGTCTGTACTCCCATAGCCCGGCCATGGACGAACACATCAT
CGAAGTAGCTGGGCGAGAATTCTTGTACATATCTCAACAGAATTGTCACACATCGATTAAATGTGGCAGGGGTTCTACTTAGCCTTTTTGGCATTACCAA
CCACTCCCAACCACTCCCAAAGCATGGGGTGCTCACTGCAGTATAGGGAATATCCATTTTGCGCATAACGATCTGATATAATCCATCCATCATATCGATT
GACGAAAAGATGGTTACTCTTTGCCATACCATCGATGATGAAATCTTCCCTTGGTATTGGTGTTCGAGCCGGCACAGTTGAAGAATTCAACTTGTTGAAG
GCATGTACTATCCGCCACCCTCCTGTGGCTTTCCGCACACAGAAGGTCGGAGAGCTATGTGGGGAGGTCAATTCCCTCACATGGCCGATTGATGAGCGAT
CTGTAAAGCCTTTGTCGATTGGTAGTACTTGTTCACAAGGCAGTGGCTATTGCTTCATGAGACAGTACTTCAAACCCGGTTTCAGTTCGATTTTGTGACG
AGTACCTTTGTCCTTAGGTAACTTGCACGGCACTGCTTCTGGTAATGCACCCCTAAATTCCATCAAATCATCGTAGAGAGGATTTGCTTTGAGTGATTCC
CA