Description :
From Genome Similarity Track
Location :
contig_75:121644- 127062
Transcript NameFunction/comments
g12340.t1hypothetical protein
g12341.t1hypothetical protein

Sequence
5418 bases(100 bases per row)
TCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGAG
TTCCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGACCTTCGTGATCGAGTTGCATCAGT
GCGCATCCGATCGCGAAATCGGATGCATCGCACACCACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGA
CTGCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCAC
GTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACGTTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCA
GGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTCGCA
TGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGATTTCCCATTCACAGCCCGGCTGTGAATGAACACGTCGTCGAAATAGCTCGG
TGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATCACGAGCCACTCCCAGAGC
ATGCCGCTCGGAGTGCTTACCGCCGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTAC
TCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGCGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGTGCCA
CCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGACCTGCTCACGCGGCAGTGGCCACTGTCGCGTGA
CGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTGTCCTGCGGTAACTCCGCAGGAATGTCGGCCGGGAGTACATCCTTGTACTC
ACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCA
GAGATGAGCTGATTCAGCTCTTCTGCTTCACATGTCATCCTCTCGACGTCCGAGAGGATGCAGATCTGCTCGATGCGTCCATCGTGCAGTTCGCGAGCGA
AACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTATTCAGCCTCATCTTCTTGTATTGGAGACCAATACTCGTACG
CGTCAAGACACTCAATGTCTCGACGGTCGTCTCCAACTCCTGTGTCTGCCCGGCAGACACTGCTTGTAGCGTCTCGGTCCCTGACCGAGACTTGCGCAGC
TTTTCTCGCTTGCGCCGTTCACTTCTCGTGCGGAGCCCGGCTCCGCGAGTTTCTTCTTGTCCAGACCCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGG
CGGGTTTTACCCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCACCGCTTCGTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGC
GGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCGTCTTCTTTACCTCTACGCCTAACGGCGGAGTGTCTTTCGACAAAT
TGTGTGTGTCGACACGACCGCGTCGCCCCGGACGCTTCGAGACCCTCTCGAATCCGATTGAATCAGGCCCTGCTGATTCGTTTCACATCTTCTTCCAACG
ACTCTCGCAGTCGTTGGCGTTCGCTTCGGGTGACCGGAGACAGCCGCATTCCGCGCTGTCTCTGATGGAGGGCCGCATGCACCACGTGGTGCATGTGCTG
CGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCA
CGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCGAGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGGTAAGAGAAGCGTACGCGTACGATA
CGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTCCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCA
GTCGAACAAAGTTGTTCGACGCACCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATC
TTGTTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGGCGCCCC
GCGCCTGCTGGTCCCTTTAATTTTTTTTATTGCCCGTGACGATACCCAGTATCGCCACTTCGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGG
CATAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGGACCAGCAGCGGTCGCACTCGAGAGGTCCATTGGTTC
GGGACCTCCCGACGGCCTTTTCACCGGTCGTGGCATCAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGC
GCAATTGCAGCCTCGAGAGTATTTGGATACCCCTCGGAAGAGATAGATCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCC
TCGTCAATCGGGTTGGTCACGATATTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCG
CCCTCGATCGGAACTCGTTCTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCCTCGTACGTGCTAAAGCACGTAGGATCTGTGAGTCGGCG
TCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGCAATGGCAGTGTCG
ACCTCGACAAGCCAACGGAGGAGAGGCTCCCCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGAC
ACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGCGATAGCGTTCGCAACATCGTTGCTA
CCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGT
GTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACA
AAGTGCTACCAGGTGTAATGGTCTGCTTAGACCCACTACTAAGCTTACACGTGTGCGCACGTGTATGAGGAAGCGTAGGAGTAATTTACTTAAGTTTAGT
ATACTTGTATCCGCAAGTATACTGAAACCTAGATAAAGGAACCGAACGATAGCTTTGGTGCCAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCC
TAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACC
AGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTATCCCTTAGTGCATGTTGCACTAAGGTAGGAGGTGAACCGAATGT
GTAGCCCCGCTACACGCACGCTGAAGCCAAACGAGCTGAACTACGACATCGTCGAGAAGGAAATCTTAGCACTCTTGCGCGTCTTGAGTGACTGTTTCAC
GATGCTGGCCGGGAAGACGGTCCGCATCTTAACCCGCCACACGACGATGGCTTGGTTGTTCCGATCTAAGAGACTGCAGGGACGCCTGTCACAGTGGGCC
GCGATCTTGTCGCCATGGAAACTGAACGTTTGCCGATCCTCGATCTAGTGTATGTTGGTCCGGAGTTGAGACGCCAAAAACAGGATAAACATCAATGCAT
GACCGTGACTCCGGAAAGTGGTGACCCTCTTTCAGATGAACTTCGTCCTGAACGAGTTCTATCGGAAGGTGTACGGCCGGAAGTACAAGATCCGGATGTA
CCTGTTGAGTTCCGATTGGGACCAGGCAAACGATATGGCTGGTGGGAAGACCACTGTTCAGATGACACGAAGCGGATTGCGATGGTTCACGGAGTGGTAA
ACAATTGTCGGACAGATATCCTTTTGGATTCCGGAGTGTCAGTAAGCATGGCGATCTTGCGCGTAGACTCAAACTCAAGCGAAGTTTCTGCAAACAGCTC
CGGGTATCTGGACTGGGTGGCGTTCCGACCATCATCACCGCGAGTGCTGAAGTGAAAATCACTTTGGGTCCGAGAACTGTGTATGTCTTGGAACTTTGGG
TCGCGAACATTGGTGAATGTGTCGACGTGTTGCTTGGAATGAATTTCATGTATTCCGCTGGAGTGCGACTGTGCGCACGAGAAGGATTGGTGCAACTTCC
GGATGAAGAAACTGTGTTGCTATCAGGACGTGGTGCGGATCAGTACCACAGAGGTTTGGACCTTCCGGTGAGACCGCGTGAAGAGCTTTTCCTGCGCCCA
GGTGAACATGCTATCGTCCGGATACATTACGGACAGAGCAATCCACAACGTGATGTGGTATGAGCTGGTCGAGGAGACCGATGGGTAACCCAGATCATCT
ATGCTGTCCCGGCGAGTGTCCTTCATGAAGGTGACGAGGGCTGGGGTGAAAGGAAAGCTTTCCTTGCGCCCCTGCCCTTTTATCGTCTTGGACAGCTTGT
TTCCTGCGTACGCTCGGAGCTTGTCACGCGCCCGCCACCACCCGTCCACGGTTCCATGGGGGTACCGAAGCTCGTCGCGGTCAAGCCGATCCGCTCGATG
GAGTCCAGCGCCACCAGCTTCACCTTCACGGTGTAGCTATGTTGCTTCCGCGGCATTTGTTGCAGTGGCAGGACTGGCCGGTGCCTCGGCGTTTTAGCTG
CTGGCCATCCAATTTTTA