Description :
From Genome Similarity Track
Location :
Scaffold_15:121642- 123346
Transcript NameFunction/comments
Phymu_g1090conserved hypothetical protein

Sequence
1704 bases(100 bases per row)
CCGCTCAGTCTGGAATTCTCCGCGTACCACGCGCAATAATGGCGACGGACCTGCCGTCCCCGCTGTACTCGGGCTTCTTCCCGCAGATGGTGCTgacggt
ggaggagctcatgcACTACCGGCGCTTCGGCAAGGAGCGCGTGGCGCAGCTCGTGCGcatcatcgacgacgcgGATTGCGTCTACCGTTGGACAGATATT
AAGGCACGAAATGGGCGATCGGTGCAAAAGGCGCAATTCCTGGATATCCAGCCGAGCACCAAGCAACCAGCATCGCAACAGCCCTCCACTTTACTGAAAT
CTAGTGTCCATATTGTGGATGTGCAGCCAGAGGAGATTCTACAGGCTATTGCCAAGGTTAAAACAAAAGACGCGCGCCGAGCAATGAGTTATCTCCATGG
AGAGGAGCTCATGGATACGCAGACGTTGCTGACGTTCCCTACGTCCTCCGAGCACAAGAAGCCCAGTTATTCCTACAGAGCTGTCAAGTGGTGTCTACTC
AAAGCtaagagaagagaaggacAGAAGAGTCTGGACTTTTGTTATCTAGAGTACGCTGGAAAGAGGAAAGCGCATGCAGCAGCCAGTAGTGTGGTGGGGT
TCTGTGTACAGGAGTCTATTGCCAGAGACCGAGAGGTGCCTACACTGGAGAGATACGATATTCTGCGGGGCCAGTTCGTGCGCACGGGTATCGTGATCAC
CAGGACGCACCAGTCCAACATCCTGAAGGTTACTTCTATTGCGCAAATTGACGGAGCGATGGtgcctgctgcagtgcgGATGACAATGGAAGAGATCATG
GTGGATTATGTGGCCACAGTGCATCGCGTTAAGGGACTACTGGAACGGCAACGGATGGGGAGATTGCAGTATCTGGACGAATGGGAGTGGGTCTCCACTA
AGGAACGCAAGGCGTGCGCAGTTTGTCTTCGTAACTTCTACTTCCATCGGAAACATCACTGTGCGACTTGTGGAGAGGTGGTGTGCTCCAATTGTGCCCC
TTTACGGGAGCTAGAAGAACCTCTGGATGAGCATACACATGCTATGCGTGTGTGCTCCTTGTGTATGGCTCAAGCTGGCAGTCATCGCGACAGCAGCATG
TCTGGAGTTACCGAGAGCGAAGATGGCATGCTGGAGACAACCACTTCCACGACGAATGTTGGTACTGAGACGTACGTTGGAGGCTTGCGGTATCCAAAAC
ACCGAGGGCTGCGGCGAGGGGGCATAGAGGGATCTCTGCGCGGATCTTCGTCGCAGGCTACCCCCGTGCGctcaccacttccaccgtTTCGACAGCGACA
TCGCCCACCCTCGAGTCGTAGCAGTGCTCAAGGTAACGGTTACGAGTATGAATCGGACGGTAGTGAACAGTATCAGCGAGCGGCTTCGGAGTCTGCACGA
CGAGAGCGGCGGTCAAGTGTTCTTCGTCACTCCACGTTGTCATCTTCGACTATGTCGGCTCAAGCGAAGAAAGAAGCTCTGGATAAATTAGTGGAACATG
TTCGCCAAATTCGTGACACGATCAGCGTGGCAATCTCTGAggccgaggaagaggaagaacgtCACAGCCTGATGCTCGAGAGCGGTCGTGGAGATCCGGA
CGCCGGTGCAGAACGGTACGATGAGATTTACGACCGTATTATGAAAATCCGAGAAACGCTGGACGTGTCGAGCTTGGATTTTGATGCTGTGCTCGAGTCT
ATCG