Description :
From Genome Similarity Track
Location :
Scaffold_14:121628- 124555
Transcript NameFunction/comments
Phypl_g655hypothetical protein PHYSODRAFT_325756

Sequence
2927 bases(100 bases per row)
TAGTGctaatagcactactagtAGCACTACTAGATACTATTCTGACCGAGCTAACTTCAAGCTACCTGGATCTTCGAAAGGGCGTGGCGTGGCAATGGGT
GGTTCTCTGGCCTCTCCCTCCTCAGCGCGTCACTCATTTCGGAAAGATTCACTCCAGACTCACAGGCGATGAAGTGCGCGAAGATTGACTGCAATTGGGA
AGACGTTCCGGAGACTTCTCCTTGCTGTGTCTGCGGCCGCCAAGTGCACCAtttgtgcagcaacgagctctgCATCACAGCTGAGCTTTCTAAAAGGTAA
CCCAGCAATCTGTACCCGTTTGATTCCTCTCGTCTCGAACTGACAGCATGGATTGGCAGGTTCTGCAGCCGCAAGTGCATCAGGGAGTTCTTCAGCGCTG
AGAGCGACTCGCAGGAATTCACACCGAGTAGCACTTCCGGGATATCACTTTCGAGCAACACGCTGATAGACCTTGCGCAAAACGAGGatgaggagaagga
gacaGGCACCACAAACAGTATTCCCGGTCACATTGTCCACGGCCCTCCAACAAATTTGAGCGACAAGGTTTGGGAGTTGATATATCGCGTGGACGAGCCT
GTTATGTATAGGGGCAAGTCATTCACTCACATTTGTCTGCTGTGTCTGgagacgaagagctggaaaGAGTCACTGTGTCGTGCTAGTCACACATCAAACG
CCAAAGCGTATGTGCTTGCTGCTCATAAGGAACACACGTTGGCTgtcaaggagcagcagcatcggctCAAGTGTACCGATCGCTACACAGTGAAGGTGGC
CACGAAGCGAGAAGTGCAGAGACCTGAAATTAATGCTGAGCCAAGCGCAGACGGCACGCAGCCAGCGAAACGTCAGAAAACTTGGTGGAAGCCCCTGCTA
GCCACGATCAAATCACGGGTCATATTGCGCAGGGGCTAATTCGTGATGGTGCGTGCCTCAGTTCCTGCTGTCGTTGTTTCTTTGGTTTAACGTACTTGTT
TGGTGTAACCAGGGCTGCCCTACAACATGGTGACGACGCCAGCTTTTCGTGATTTCCTAGTCGGTGTTACTGGTGACGCTAATGTTACCATACCATCCAG
CAAAACCTACAATGATATCCTCGACAACCACTACGACAAATTCAAGAATGGCGCCTCGGAACTGTTCGCAGAGGAGTTTAAAGAGCTACATGGAACAGGG
TTCATGACCGTGGAGCACGACTTGTGGACCAACAGCTCCAAGAACTGCATCGTtggcgcttcctgcagctttATTGGCCGGCACTGTCGACCAAAAACCT
GGTACTCCTGGCACAAGTCAAAAATGATGGACATGACTCTGAGGAGGTTGCTGGGGTGCTGGACGAACAGCTGAAGGCCCGCTATGGCTTGGACGTGAAC
TAAATGGCTCGTTTTACGATATCTGACACAGCTGCAACCGCTCGGACAGTTTCAAGGCAGTTTGACTCGACTCTGCAGACAGACTGTACACTGCACGCCC
TCAACCTTTGTATTGGTTACGGAATTGGGCTAAAGAAGAACGTGCACAATGTTTACGTCAAGGACCCAAAGACGGAAGCGTTCGTCAAGAAGCGGCTCGT
AGTCACCGATGGTGGAGCGTTCCCGGAAGGTAGCGCGGTGATTCGAAAGTTGCGTGCTCTCAACAATTTCTTCGCCTCGAGCAGGTTGCCTGAGCGTATT
GCCCGCCTCACCGAAGTTCAAAAGTTTCACAAACTACCTCAGCTGGCAGCTCTGATTGACGTCGACGTCCGCGTGGCTTCGACAATCAAACTCTTCCGTC
GTTCTATCATCAATTATTCGGCTTTCTTGGCGTTCTTTCAGAACGCGAGCGTGGCAAAAGACAAAAACGACGTCTTTAGCTGTATTTCTCTCTCCGAGTG
GGAGTTGGTGACTCATATGGAGGCAGCAATGGAGCGAGTGGCGGAGCTAGCCCTGGTTGAATCTCAGTCAGCAACTATGCTCCCGTCTACGGTGtatgtg
ctgctgcgcgtggcaTCCGCCAAAATAAATTCGTACAAGTTTTCTGCGTACTGTTTGAACGGAGCTCGTGACCCGACCACCAACGAGAAAAAACTTTCCA
CGGGTCCAGCTAATGCTGACTGACCTATCGGAACTGACCCAGCGCTGTATTAAGCGAACACTGTACCAGATCGCCGAGCGCCTACCGAAGCCGTCAATAT
AAATGGGCATGGCCCTGCTTCTTGACCCGCGGACCAAGGCAGCAGCCAAAAATTTCCTGCGCATCCCCGACCACACGGAGGCAGCAGCCGACAAGCTTTT
AGATGAAGCAAAAGCACTGATGCGCGTCGAGCATAGTCTTCTACAAAACCCTCTATGCGAACGTCGGTCCAGGAGGCGATACAGTTGCTTCTACTTCGAG
TTCACCACATGGGgacggcaacagcagctctgACACTGAAGCGGACTTAGTGTACGGGGAAGAGGTATCGCAGCCGGCCGAGGAGAGCACTGCTGATGCT
TCGCTAAACGCGAAGGCCGACGCGTTATTGGAAGTGTGGCTCGGCTTCGAGTTGAGTGGGCCGAAGTGGTAAAGAGGCAATACCCCAacaaggacgagct
cgatAAGGTGTTAGCCAAGCTGGGCGCGCGTGATCGGAAGCGAAACGTTCGCGTGTGGAATGTGGAGCAATTATGCGGGAACGTTGACATTTGTCGTTGG
TTTGCAGAGGTTGGCCAGGGCGCGTACCCATCAATTGCCAAACTAGCACGCGTCTGGCTGGGACGGGGTTGCTCGACGGCGTTTCAAGAACGGGTGTTTT
CGACAGGCTCGTTTGTATTGAGCTCACTGCGCACACGGACGGACAACGAGTGAGCCCAGCGGCAACTGATACTGCGTCACAATCGTCTTGAAACCAGGCG
AATGGAGGAAAGAAAGAGAGAGCTGCG