Description :
From Genome Similarity Track
Location :
Scaffold_3463:1216- 2537
Sequence
1321 bases(100 bases per row)
ACTTGATCTGGTCCCAGCTCGATGTGACCAACTCATATCAGCGATCCTCCTCCTCCTGACCCACACCCTTCCTGTGGGTCCTTCTTCATCCTCCCATCGA
TATGACCAACTCACATCCATGGGTCCCCTCCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTTACGATTCGTACGATCCCTCAAGAAATCATA
GAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTAGGTTCGTCATATCCACGCCAATGCACCAGAAACTCACGGTAAATCCGTCCGTATCTA
GTTCGCTTCCCCGATCTCATATCGGTGATCTTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACATTCCAACTGTCTTCCGGAAGGAGAACTTCGTCAA
AGTCGACGCGGTCGGATGCATCTACCGAAAGACGGATCTGCGGCCGATCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAG
GCGATATTCGGTACCTGCCGTTTCCAGCCTCACCGCATGTGCTCCAATCTTCTCTCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGCGAGCG
TACCCTTCTTTCACTCGATCCAAATAAAGCCACACCTGCGATCCCACTTGGGATTTGATGTGGGACGGGCGTCTTCGTTGTGTCGATCCCGCTCGATCCT
GTATCGCACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCCGGTAGTATTTCTGGACTTGTTATCGCCATCGCCTCGGATCTCGGTTTCTCTTCTT
GGTGCTGCATACTGGGATGGCCGCTTTCAGGGTGGATTTGGGATCCCAGCCATGTACCAAGTAAAATGGGGTATCACCCCGGATCCTGTCTTGGGCGGTG
TTCATCGCGAAGGGGAGTCGTTCTGCGTACTCATCCCAATCCATCTGATCCAAATCCTGAGCACACATCTTGAGCGCCCTCGTGATCGTATGTACCATGC
GTTCCGCCGATCCATTGGCTTGGGGACGATATACCATAGTCGCCCGCTGGATTTGCCCCAGGATCCGTTTGAAAGCTCCAAAGAAATCAGACATAAAGCC
TGGCTCCCGATCATGTCTAATCATCTCGCTAGCTCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCAGCAATGGTCTACGCAGTTCTAGACGCACTA
GCTTTGGCTACCACGTATCCGGTAAACAGGTCCACCCAAATCCACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTA
TAATTGGAAAGGGTAAGTCGC