Description :
From Genome Similarity Track
Location :
Scaffold_6:1215932- 1217168
Transcript NameFunction/comments
Phyin_T30-4PITG_04562Mucin%2C putative

Sequence
1236 bases(100 bases per row)
TAGGCGCGTTCGTCCACTGCGCGTTAGATCCGCTGCTTGACCCAGTGGTTGACGTTTTAGATCCTGAAGATAAAGTGCTGAGTCCTGGTATGGGGTGAGT
CGTCCATGGATTCGATGCCTGGGTCGTTGACTTCGGCAGTTGAGTTGGTGAGTTCGGCACAAAGCTAGAACTGGAGCCTGAAGAAGATCTCGCAGTAGTC
GAGCTTGGATGAGTTCCTGAAGTCGGCGTATTCATCCACGGCGTCAGTGTCGTTGACTCCGGCGTCCGTGTTGTCGAGGTAGGCGTGTAACTAGCACTAG
AGCCTACACTCGATTTCGAAGAAGACGAACCCGTTTCTGACACGGGAGCATTTGTCCATTCGCTCGGTGCCTGCGTCGTTGACTCCGGCATCTGTGTTGC
TGTGTCTGGATTTGACTCGTCACTATGTGGCGACGGCTCTGTCGTTGCCAGCGTGGTAATTCCTGCTGTTCCTGGTCTAGACCTACCGTCGTTTTCTGAG
CTTGGCGCATTCGTGACCGGTGTCCAGTCAGTCTCTGGTGCTTTAGTCGTCGCGCTAGGCGTCGCTGTCGTCACCGTCGGACTGGAGTTTGAATCTGCCT
CTGGGTTACCACTTAAAGCTCCAGCATTCGTGTCGGTGGTGGCGCTCTCGCTAGAATCTGCAAGGCGAACACTCACCTCAAGTTGTCGGTAGTCGAAGGG
TTGCTCCGCATTTACGACGCCCGTCGAGCAGACCGCGACGGCAGCTGCAACGACCACTACGAGCGCTCGCTTCCTTGAATGCCATCGCGGTCTCCGTTCC
ATCCTGTCGAATAAGTTAGCGTAAATAGTTCGTGCTGCCCCCGCGTCGTTTTGTCCTGTATATCTGTGCGTTCTTCCTCCTCTGTCCTCCTGTTTGTCTG
CTGCCTGGTTTGCTCGCTCGCGTGCGCGCTCGAACCGTCAGTGGTGACGGCACGAAAGAGAGCGCCGACCGAAGACTGTCTCGCGCGAAGGGAGAATGCA
CGGCGCTGTATTATTACCTGGTGGAGGTGTCGGAACGCACGGATAGCGACGGACTGGCCTTGTGGTCGCCACCATTTGCTCCGCCTCTACAGACAACGGC
TGTTACGTGGGACTTTCAGGTCAATCTGGATTTTTACAAGGAGTTGATACTTATTGTTGACTTTTTATATTAGAAAGAATGTGTTTTAGGTGTACCACAC
AATAGTAGCAACANNNNNNNNNNNNNNNNNNNNNNN